1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
prisoha [69]
3 years ago
12

A frog has a genetic mutation in its skin cells that causes part of its skin to turn orange. The frog will not pass this genetic

mutation onto its offspring because A. mutated skin cells cannot divide and produce daughter skin cells. B. the offspring will inherit skin cells from the other parent. C. parents do not contribute genetic material to their offspring. D. skin cells do not contribute genetic material to sex cells.
Biology
1 answer:
Kisachek [45]3 years ago
6 0

The frog will not pass this genetic mutation onto its offspring because, D. skin cells do not contribute genetic material to sex cells.

You might be interested in
A good model of the cell membrane would be
mixer [17]

C. A wall of stones and mortar

This would act as a model describing the cell membrane.

Explanation;

A cell membrane is made up of a phospholipid bilayer with embedded proteins.

A cell membrane hold the different components of the cell together and to protect it from the environment outside the cell. It acts as a boundary between the inside environment and the outside environment of a cell.

It regulates the materials that enters and exits the cell; through selective movement of substances in and out of the cell.

6 0
3 years ago
Being a visual learner have you got any tips on how to study science?
sukhopar [10]
Even being a visual learner the trick is to take notes, even if you never look at the notes ever again its good to write them down, you are more likely to remember something you have written down rather than to just look at it. Science is something that could be easy, you just have to take it at your own pace, don't try to learn science by giving it a quick read or glance at it.
7 0
3 years ago
COMMON TOPICAL MEDS<br> What are the effects of oral drug administration
ddd [48]

Answer:

Dry Mouth (Xerostomia)

Fungal Infection.

Gum Swelling (Gingival Overgrowth)

Inflammation of the Lining Inside of the Mouth (Mucositis)

Mouth Sores (Ulcers)

Taste Changes, Including Metallic Taste.

Tooth Decay.

Tooth Discoloration.

4 0
2 years ago
Why are dead or weakened viruses used instead of normal viruses to create a vaccine?
vodomira [7]
I think its because vaccines are just to help your body learn how to fight off the virus, it’s not to actually give you the virus. Hope this helped!
5 0
2 years ago
Read 2 more answers
A)shrink<br>b)swell<br>c)neither ​
BlackZzzverrR [31]

Answer:

b)swell

Explanation:

good luck

7 0
3 years ago
Read 2 more answers
Other questions:
  • Where do the cranial nerves originate? Where do the spinal nerves originate?
    8·1 answer
  • Is it true or false
    5·2 answers
  • Differentiate between plant cell and animal cell
    9·1 answer
  • An example of anabolism is A. glucose oxidation to pyruvate. B. breakdown of starch or glycogen to glucose. C. oxidation of fats
    13·1 answer
  • What happens if there is not enough ATP available
    12·2 answers
  • Enzyms are used for
    10·2 answers
  • PLEASE HELP ASAP<br> What are the three stop codons? What is the start codon?
    6·1 answer
  • What is the common Characteristic is shared between a tree, a shark, a human and
    7·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Scavengers make detritus
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!