1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Reil [10]
3 years ago
9

What is a buffer and how can it help reduce human impact on water pollution?

Biology
1 answer:
Irina-Kira [14]3 years ago
5 0
But planning and maintaining But first you can help to prevent some of the most serious environmental land and aquatic habitations reduce the quality of water for human consumption buffers protect the environment
You might be interested in
BRAINLIESTTTT ASAP!!! PLEASE HELP ME :)
alexgriva [62]

A) A metal forms a + charged ion, so D2+

B) A nonmetal forms a - charged ion, so A-

C) C2-

D) B+

6 0
3 years ago
The Krebs cycle and electron transport take place in which part of the cell?
babymother [125]
It takes place in the mitochondria.
7 0
3 years ago
Both primary and secondary succession have pioneer species that-
il63 [147K]

Answer:

hi

Explanation:

8 0
3 years ago
Read 2 more answers
Hi can you please help. Brainliest and pts for correct answers.
bixtya [17]

Answer:

It has many predators in the ocean.

Explanation:

Animals adapt to their environment because of their predators.

7 0
3 years ago
2.
prohojiy [21]

Answer: Option B. core samples

Explanation: this is the only option that is not used for locating minerals

4 0
3 years ago
Other questions:
  • Pleaseeee help!!!!!! I will mark you as brainlinest for correct answer!!!!!!
    14·2 answers
  • The Cretaceous-Tertiary extinction was most likely caused by _____. an asteroid hitting the earth volcanism both a and b none of
    6·2 answers
  • Is chloroplast photosynthesis cellular respiration or both​
    11·1 answer
  • Suppose you are involved in a project studying a population of Dalea purpurea (purple prairie clover), a diploid, bee pollinated
    12·1 answer
  • A solar system has the five planets shown below. The mass of each planet is proportional to its size. Planet X is at equal dista
    13·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • What is the optimal temperature for photosynthesis?
    8·2 answers
  • Scientists use restriction ________ to
    5·1 answer
  • ADDING unsaturated fats to a diet high in saturated fats will help lose weight and increase heart health.
    8·1 answer
  • Plan a good post-workout meal with both carbs to replace _________________ stores and protein for muscle ______________ and repa
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!