1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
krek1111 [17]
3 years ago
15

What is an effect of adaptive radiation?

Biology
2 answers:
zloy xaker [14]3 years ago
6 0

A.) Many new species form

Semenov [28]3 years ago
5 0
I'd have to say it'd be the dramatic increase in the diversity of the population gene pool.The increased diversity can lead, in time, to a dramatic increase in the number of distinct species in an environment.
You might be interested in
Label this bacterial cell ASAP
irina1246 [14]
A= cell wall
B= cytoplasm
C= Plasmid
7 0
3 years ago
The cycads, a mostly tropical phylum of gymnosperms, evolved about 300 million years ago and were dominant forms during the age
Andrei [34K]

Answer:The Cycad tree is the sporophyte.They have flagellated sperm.

Explanation:

During pollination, the contents of the megaspore divide to form many–celled gamateophyte called the endosperm and archegonium. There is a micropyle opening with a sticky fluid, which traps the wind-borne male gametophyte (microspores) which,at this time is made up of prothallus cell;an antheridial cell and a large tube cell. The trapped microspore is sucked into the archegonia chamber. Antherizoids are released, but only one penetrates each oospore and fuses with the female nucleus. The zygote is formed in the ovule and the later develops into seed.The diploid seed germinates into a new sporophyte plant and the life cycle begins again. Examples of cycad include Cycas circinalis ,Cycas celebrical and Cycas revoluta

8 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Why do you think so many different foods are provided at one meal?
Darina [25.2K]
It’s to get all your different bones the right nutrients they need so they do get weak.
8 0
3 years ago
Read 2 more answers
Which of the following is most likely to be a secondary pollutant?
Pepsi [2]

Ozone would be the secondary pollutant because it is caused when two primary pollutants react. Hope this helps!

3 0
3 years ago
Read 2 more answers
Other questions:
  • When a muscle is stimulated to contract aerobically, less lactic acid is formed than when it contracts anaerobically because:___
    5·1 answer
  • Explain the difference between hybridization and inbreeding
    8·1 answer
  • Oceanic crust is generally lower in elevation than continental crust because oceanic _____ is _____ than continental crust.
    10·1 answer
  • A population of lizards lived in an ecosystem that was prone to flooding. After many generations, most of the lizards in the pop
    14·1 answer
  • What is a stem cell?
    8·1 answer
  • How are viruses different from other living organisms?
    6·1 answer
  • Help me plz!!!!!!!!!!!!!!!!!
    7·1 answer
  • How might a protein lose its structure?
    6·2 answers
  • Cuántas cadenas de ADN diferentes de 20 nucleótidos se pueden construir con las cuatro bases nitrogenadas?
    14·1 answer
  • I NEED HELP PLEASE I WILL GIVE BRAINLIST<br> if you dont know dont comment or aswer please
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!