1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
german
3 years ago
12

Energy flows from the producer level to the

Biology
1 answer:
OlgaM077 [116]3 years ago
7 0
<h2>Answer:</h2>

<u>Energy flows from the producer level to the consumer level.</u>

<h2>Explanation:</h2>

In any ecosystem, Producers are those species which make their own food. The best example is any kind of green plant. Green plants make their food by taking sunlight and using the energy to make sugar. On the other hand The organisms that obtain their energy from other organisms are called consumers. All animals are consumers, and they eat other organisms. So we can see that energy always flows from producers to consumers.

You might be interested in
Why is an environmental contingency plan important?
Y_Kistochka [10]

Answer:

B

Explanation:

3 0
3 years ago
Read 2 more answers
Which statement best describes a capsid?
Nezavi [6.7K]
C. A capsid is a protein coat that protects the genetic material of the virus
Hope that helps!!
8 0
4 years ago
Which is an inference?
Yanka [14]

Answer:

After watching a plant for a week, you determine it needs more sunlight.

Explanation:

Inference is a process by which, through certain data, a conclusion is reached. Other synonyms for inference are conclusion, implication, ilation and consequence.

Accordingly, an inference is made when after watching a plant for a week, you determine that it needs more sunlight. This was a conclusion based on data.

Not all inferences offer true conclusions, even with data analysis. It is possible to state that all dogs are furry animals with four legs, but it cannot be inferred that all furry animals that have four legs are dogs.

Inferences usually arise from an analysis of characteristics and probabilities. If someone makes reference to an animal with four legs, hairy and wagging its tail, it can be inferred that the most certain thing is that it is referring to a dog.

6 0
4 years ago
A cell containing both sets of homologous chromosomes
AlekseyPX
Hello Brainiac

Diploid is a term used to refer to a cell that contains both sets of homologous chromosomes.


I hope that helps!
7 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Other questions:
  • "which activity could lead to carbon monoxide poisoning?"
    7·1 answer
  • ​the pulsing of your heart while you are lying or sitting down is your ____.
    10·1 answer
  • Which is a function of the protein hemoglobin?
    11·2 answers
  • What is the predominant hypothesis why animals only appeared in the fossil record about 3 billion years after life originated?
    13·1 answer
  • The rate at and the extent to which a nutrient is absorbed and used is referred to as its ____.
    10·1 answer
  • Slow release of bacteriophage progeny from a bacterial host cell A. does not kill the host cell B. is a feature particular to fi
    14·1 answer
  • True or false ? Osmosis is the movement of water to equalize pressure
    7·1 answer
  • What is the answer with explaining
    13·1 answer
  • What are the different types of competition?
    9·2 answers
  • Which of the following is the central issue underlying a problem that needs to be addressed
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!