1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AleksandrR [38]
4 years ago
6

What is the difference between heterozygous dominant and homozygous dominant?

Biology
1 answer:
sattari [20]4 years ago
7 0
The genotype of :
-Heterozygous : Aa
-Homozygous Dominant : AA
-Homozygous Recessive : aa
You might be interested in
Milk would be classified as a _________.
artcher [175]
Pretty sure a weak acid
6 0
3 years ago
Read 2 more answers
How can scientific conclusions be reliable, but also able to be changed with the introduction of new evidence
aleksklad [387]

Answer:

scientific conclusions are reliable as they are helpful for many things however it is true that after the evolution of new ideas the old theory have some changes or may change fully or may be proved wrong but yeah the old theories are still helpful for many reasons and things.

so I think scientific conclusions are reliable

8 0
3 years ago
Gwen is a forensic technician. One day, the police send a skeleton to her lab and ask her to identify if it belonged to a male o
Artemon [7]

Answer:

(B)iology

Explanation:

Biology is a branch of science that studies about the living organisms.

4 0
4 years ago
Read 2 more answers
How many nucleotides are there in a codon?
cestrela7 [59]

Answer:

three

Explanation:

Each codon consists of <em>three nucleotides</em>, usually corresponding to a single amino acid. The nucleotides are abbreviated with the letters A, U, G and C.

6 0
3 years ago
Read 2 more answers
A population that increases 5 percent every year is said to be experiencing
Nata [24]
<span>They are experiencing Exponential growth</span>
5 0
3 years ago
Read 2 more answers
Other questions:
  • How does the sun's energy enter into a food web
    11·1 answer
  • Mary Shelley traveled to Switzerland so that she could find a quiet place to write her novel.
    10·1 answer
  • Women have sex chromosomes XX, and men have sex chromosomes XY. Which of a woman's grandparents could not be the source of any o
    10·1 answer
  • What type of conditions can lead to the development of karst topography?
    6·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • In a clinical trial, a company that manufactures medication to fight the flu virus tested it on 10 men, ages 20 years to 30 year
    14·1 answer
  • [ ANSWERED]
    15·2 answers
  • Who discovered the cell fir the firat time ? What procedure did he follow?​
    13·1 answer
  • Read the excerpt from Narrative of the Life of Frederick Douglass. Identify the tone in the following sentence.
    14·2 answers
  • Select the correct answer.
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!