~Hello there!
Your question: When animating mitosis, only five key frames are needed for the computer to fill in the rest of the animation. What is this process called?
Your answer: When animating mitosis, only five key frames are needed for the computer to fill in the rest of the animation. This process is called tweening.
Any queries ^?
Happy Studying! :D
Answer:
The correct answer would be option C.
Plants evolved different methods to prevent or reduce the effects of photorespiration.
The C3 plants are the most common plants which do not have any special methods or physiology to prevent photorespiration.
The C4 are the plants in which carbon fixation and the Calvin cycle takes place in different cells. Carbon is fixed in the mesophyll cells with the help of PEP carboxylase enzyme. It fixes carbon and converts PEP into oxaloacetate. The Calvin cycle takes place in the bundle-sheath cells.
In contrast, CAM (Crassulacean acid metabolism) plants are those in which carbon fixation and Calvin cycle are separated into time. The carbon is fixed during the night as it helps in reducing the loss of water through transpiration.
The Calvin cycle takes place during the day time in the same cell, that is, mesophyll cell.
Muscle, hair color, height are the 3 most common physical traits affected by the environment.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
