1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
masha68 [24]
3 years ago
9

Which example illustrates Darwin's main contribution to the theory of evolution? A. An agricultural pest has been exposed to a p

esticide that wipes out the entire species. B. In a laboratory, a scientist chooses the most intelligent mice and breeds them to advance the species. C. When exposed to antibiotics, most bacteria in a population die but some survive and live to reproduce. D. In the African savannah, a scientist observes that a wildebeest calf has inherited its coat pattern from its father.
Biology
1 answer:
Andru [333]3 years ago
3 0
C. When exposed to antibiotics, most bacteria in a population die but some survive and live to reproduce.
You might be interested in
How does gas like oxygen get across the cell membrane?
Alekssandra [29.7K]
Through diffusion is the answer

6 0
3 years ago
How many genes code for hemoglobin?
Pepsi [2]

Answer:

Four

Explanation:

Like all proteins, the "blueprint" for hemoglobin exists in DNA.

3 0
3 years ago
Read 2 more answers
How does interphase prepare cells for mitosis
Luden [163]

Answer: During interphase, the cell copies its DNA in preparation for mitosis. Interphase is the 'daily living' or metabolic phase of the cell, in which the cell obtains nutrients and metabolizes them, grows, reads its DNA, and conducts other "normal" cell functions. This phase was formerly called the resting phase.

Explanation:

5 0
3 years ago
Read 2 more answers
In an experiment, a scientist adds half a cup of fertilizer to pond “A” and zero fertilizer to pond “B” to compare the amount of
Anna71 [15]
A. dependent variable
8 0
3 years ago
Give an example of the way sexual selection can cause extreme phenotypes in a population
STatiana [176]
<span>When breeding season arrives, male elephant seals define and defend territories. They collect a harem of 40 to 50 females, which are much smaller than their enormous mates. </span>
7 0
3 years ago
Other questions:
  • A postpartum patient with hearing impairment asks the nurse, how will i know when the baby cries? what does the nurse instruct t
    5·1 answer
  • Correctly order the steps involved cellular immunity:
    15·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • What are Chargaff’s rules for complimentary base pairing
    12·1 answer
  • Which of the following cells would not divide using mitosis
    10·1 answer
  • Which statement gives an example that best demonstrates how the geosphere has affected the evolution of life on Earth?
    9·2 answers
  • Name the type of classifications of tissue formed by combination of cell.
    6·1 answer
  • How did the zebra mussel invasion cause the change in the species population?
    6·1 answer
  • What are the non-living components of an ecosystem?
    9·1 answer
  • A stop enzyme is used in protein synthesis to stop tRNA from carrying messages from the DNA to the ribosome.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!