1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
suter [353]
3 years ago
8

Do sharks have bacteria in their stomach that let them digest their food

Biology
2 answers:
miss Akunina [59]3 years ago
7 0

Well, i think it's not bacteria, its Hydrochloric Acid. For shakrs ITS REALLY STRONG, i hope this helps or answers your question! :) x

RUDIKE [14]3 years ago
5 0

No, Its hydrocholic acid when they digest not bacteria atleast that's not what scientsist call it.

~Morgan Malice~

You might be interested in
If the mouse was in a wire cage and only the weights of the mouse, food, and water were considered, would you come to the same a
zalisa [80]

Answer:

Here is the full question:

(A) If a closed container contains a mouse as well as enough food, water, and oxygen for the mouse to live for 3 weeks,

How much will the container weigh 1 and 2 weeks later after the  mouse has eaten, drunk and exercised (respiration is CO2 emission), and why?

(B) If the mouse was in a wire cage and only the weights of the mouse, food, and water were considered, would you come to the same answer as in (A) and why?

Explanation:

(A) The mouse will weigh the same. This is because solids, liquid, and gases cannot escape the closed container. All of the life processes involving reactions conserve the atoms involved. Some of those atoms will appear in the form of gases, some as solids, and others as liquids but all will be retained in the closed container.

(B) In a wire cage, gases can escape. This means that the weight will not be the same after 1 and 2 weeks. The weight would be less than the original weight of the mouse, it's food, and it's water.

6 0
3 years ago
Over time what could happen to an underwater island that forms near a mid-ocean-ridge
Semenov [28]
The plates will move and the underwater island will start to move and shift. It's possible it will also weather
7 0
3 years ago
During telophase
ICE Princess25 [194]
I think it is that the cytoplam divides
4 0
3 years ago
Key deer, a subspecies of white-tailed deer, are only found on a few islands in the Florida Keys. They are tiny deer that weigh
Helen [10]

Answer:

<em>The correct option is limited food and water resources favored the survival of smaller deer.</em>

Explanation:

The islands where the Key deer lived had limited food and water resources. As migration was not possible for these species because the white-tailed deer had more adaptations as compared to them, hence they had to somehow survive in these areas with limited food and water resources. Limited food resources were the reason that the Key deer could not grow properly and hence evolved to have very little weight.

6 0
3 years ago
If the specimen is living, then cells Fill in the blank text field 1
melomori [17]

Answer:

can you please rewrite that so it can make more sense

Explanation:

8 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which of the following chemically weather rocks? Ice , Mosses , Plant roots , Burrowing animals
    12·2 answers
  • Law of consevation of matter​
    11·1 answer
  • In this experiment, you will determine which of four variables affect the breakdown of rock samples. To do that, you will change
    8·2 answers
  • How do we use self-schemas to process information about ourselves?
    12·1 answer
  • After an investigation, Kuri determines that her hypothesis was wrong. What is the best thing for Kuri to do next?
    15·2 answers
  • Dna polymerase uses what kind of enzymatic activity in the process of proofreading?
    5·1 answer
  • Describe the neurulation process beginning with the formation of the notochord
    12·1 answer
  • Your gender, whether you are male or female is determined by the​
    12·1 answer
  • Hey <br>join<br>xnd-dxjn-fiq​
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!