1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ipatiy [6.2K]
4 years ago
15

The majority of your body's cells are diploid. These are Cells

Biology
1 answer:
Shkiper50 [21]4 years ago
5 0
Diploid cells are cells that have two sets of chromosomes from each parent. See the picture below: 

You might be interested in
Convert 10,095m/s to miles/s
klemol [59]
It gives me 22581.872
5 0
3 years ago
How can pollution reduce the rate of photosynthesis? Research work (60-90 words) unnecessarily,useless answers will be reported
Anna71 [15]

\huge\mathcal\green{answer}

Air pollution has become an extremely serious problem. Air pollutants affect both plants and animals. Under polluted conditions, plants develop different physiological, morphological and anatomical changes. Pollutants cause damage to cuticular waxes by which then they enter the leaves through stomata. This further leads to injury to plants which can be either acute or chronic. Changes in stomata due to air pollutants which seem to be small can be of great consequence with respect to survival of the plant during stress. These effects can further lead to disturbing the water balance of leaf or whole plant. Respiration also gets affected because of the exposure of plants to air pollutants. The present paper deals with the effect of air pollutants on stomata as well as on respiration leading to affect gaseous exchange.

\huge\mathcal\green{hope \: this \: may \: be \: helpful}

\huge\mathfrak\green{mark \: as \: bainliest}

8 0
3 years ago
Meiosis results in cells. <br> Each of these cells contains chromosomes.
stich3 [128]

Explanation:

meiosis cell are parent cell

7 0
3 years ago
Which of the following is not a type of white blood cell?
omeli [17]

Answer:

Erythrocytes is the answer

4 0
3 years ago
Read 2 more answers
How do you know if a genotype is dominant
aleksandr82 [10.1K]

Answer:

dominant genotypes have a capital letter  

Explanation:

really need brainliest :/

6 0
3 years ago
Other questions:
  • The medicare contracting reform initiative (mcr) was established to integrate the administration of medicare parts a and b fee-f
    6·1 answer
  • You study eye formation using Mexican cave-dwelling blind fish. You know that blindness is a trait controlled by multiple genes
    9·1 answer
  • An _____ image cannot be projected and forms where light rays appear to originate
    12·1 answer
  • You get violently ill one hour after eating a meal. what possible form of food intoxication might you have contracted?
    15·1 answer
  • What is the climate zone around the equator that extends from approximately 23.5 degrees north latitude to 23.5 degrees south la
    14·2 answers
  • Which process is catalyzed by rubisco during the light-independent reactions of photosynthesis?
    5·2 answers
  • To study the difference between two types of bacteria, which microscope should I use?
    11·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Which of the following is NOT TRUE about amino acids?
    13·1 answer
  • Someone help pleasesdesereffgfqsgdafge
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!