Eukaryotes contain linear chromosomes and therefore require telomerase to prevent loss of the ends of the chromosomes
Explanation:
Glycogen is a complex carbohydrate that the body can easily and rapidly convert to energy. Glycogen is stored in the liver and the muscles. Muscles use glycogen for energy during periods of intense exercise. The amount of carbohydrates stored as glycogen can provide almost a day's worth of calories.
the surface area of a figure in square units is the number of unit square it takes to cover entire surface without the gas or overlapse if three dimensional figure has + sides the sides called faces the surface area is the total of the area of the faces
Answer:
The temperature is staying the same. In the graph when it shows solid/liquid and liquid/gas, the temperature stays the same until it changes. This is because it reached it's melting point/vaporizing point. For example, a solid gets heated up, it then reaches it's melting point but it can't go higher than that because it isn't fully a liquid yet, once it's a liquid it will then continue to rise in temperature.
I don't think I put enough detail into that explanation but I hope this helps your problem.
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
