1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
RSB [31]
3 years ago
13

If the parent genotypes are Aa and Aa, the offspring are expected to be _____. 1/2 AA and 1/2 aa all Aa 1/4 AA, 1/2 Aa, 1/4 aa 3

/4 AA and 1/4 aa
Biology
1 answer:
yan [13]3 years ago
7 0
Punnet squares are your friend with these kinds of questions :)

   <u>   A  |  a  |</u>
A <u>| AA | Aa |</u>
a <u>| Aa | aa |</u>

Now we can easily see that 1/4 of the offspring will be AA, 1/2 will be Aa, and 1/4 will be aa. Therefore, it is the third answer that's correct (1/4 AA, 1/2 Aa, 1/4 aa). Hope this helps! :)
You might be interested in
Help meeeeeeeeeeeeeeee
GenaCL600 [577]

Answer: b

Explanation:

8 0
3 years ago
Read 2 more answers
What is the structure of your body called?
maks197457 [2]
Are there options? Structure meaning skeleton or anatomy?
3 0
3 years ago
How can a glacier made of ice erode a landscape made of rock? explain both mechanisms in detail?
SVETLANKA909090 [29]

a glacier made of ice can erode a landscape made of rock because there can be water held within the rock that gets frozen, and because water expands when it is frozen the rock breaks apart and the glacier grinds its' way 'downhill' (down a mountain range, a good example of this is the Appalachian mountain range) and carves out a significant amount of material that is below it, as well as the materials frozen inside of the glacier. so glaciers can freeze the rocks, and then scrape away any material that is softer than rock.

5 0
3 years ago
What do viruses depend on for their reproduction?
Law Incorporation [45]
As viruses cannot reproduce by themselves, they depend on the host cells that they infect to reproduce
7 0
3 years ago
Read 2 more answers
What is plant "blinking"? Why do plants do this?
Likurg_2 [28]

BLINK protein speeds up stomatal movements in response to light fluctuations resulting in improved plant growth and water use.

Plants can't move, so their “blinking” helps protect them from burning or bleaching when they are in bright sun.

I'm not sure if the first part is right, but I do know the second part is.  

3 0
3 years ago
Other questions:
  • What hominid existed 180,000 years ago
    15·1 answer
  • A cell nucleus if often referred to as the
    14·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Winds blowing across the ocean surface cause friction which results in
    6·2 answers
  • What led biologists to assign universally accepted names to organisms
    5·1 answer
  • Could someone please help me with question 21
    9·1 answer
  • ⚠️PLZ HELP⚠️
    11·1 answer
  • Match the word with the correct definition
    5·2 answers
  • Which statement is not a part of the cell theory
    9·2 answers
  • Why would different restriction enzymes cut the same DNA molecule into different numbers of fragments
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!