1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fittoniya [83]
3 years ago
11

Which of the following was the fourth leading cause of deaths in the construction industry in 2013?

Biology
2 answers:
Damm [24]3 years ago
7 0
I think the anwer is d
GaryK [48]3 years ago
6 0
D. Getting caught or between two objects
You might be interested in
What is the energy source for almost all life on earth
Katyanochek1 [597]
The Sun is the energy source for almost all life on earth.
3 0
4 years ago
Read 2 more answers
Water is split AND chemical energy (in the form of
KengaRu [80]
True hope this helps
3 0
3 years ago
Gold is opaque and reflective. It has a _____.
Dafna11 [192]
Metallic luster is your answer
6 0
4 years ago
Robert told his friend to go on the atkins diet and he begins experiencing ketosis. what would his symptoms be
uysha [10]

Symptoms of ketosis include;

Increased ketones in the urine and blood

Bad breath

Short-term fatigue

Insomnia

Digestive issues like diarrhea and constipation

Suppressed appetite

Weight loss.


<span>Ketosis is caused by an increase in ketone in the blood. Ketones are formed from the ‘burning’ of fat in the body. This usually occurs when there are no carbohydrates to ‘burn’ in the body (usually during dieting)</span>




8 0
3 years ago
How does science directly affect you? Where will what you have learned lead you next? PLEASE HELP ME RIGHT NOW!!!!!!!
Andru [333]

Answer: Literally everywhere. Having an at least basic level of science helps you in day-to-day situations. For example, cooking. Not only is it crucial to understand the chemical and physical processes when cooking, you should also understand the complexity of how these micro and macromolecule exchange processes affect you and your body. Another prime example is your health, or human processes. You might not realize this, but your body is a plethora of complex, interconnected systems and networks that work hard 24/7 to maintain homeostasis (keep you alive). Understanding how our human physiques conduct themselves helps us gain the knowledge to be able to stay alive.

7 0
4 years ago
Other questions:
  • A rock inside a building is not likely to be affected by
    14·1 answer
  • Margaret, an elderly woman, needs to limit her kilocalorie intake without sacrificing needed nutrients. Keeping in mind My Plate
    6·1 answer
  • Is it important to have a family
    9·1 answer
  • Genetic material includes two basic molecules. What are they? <br> A) ADP and ATP<br> B) RNA and DNA
    6·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • All living things need to transport molecules from one place to another within the body in order to carry out necessary life
    6·1 answer
  • Hello, I know this is a very weird question, But this is for school and we have to take an essay on it. So please be mature when
    12·1 answer
  • 3. Look at the rock cycle.
    12·1 answer
  • If an organism is in the genus Canis, what family is it in ? <br> A<br> B<br> C<br> D
    14·2 answers
  • What is the most essential element in bone marrow ?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!