Answer:
Renewable energy is over 90% of the energy use in the united states
<span>Climax community=when the ecosystem reaches its mature state. After every disturbance, the ecological succession will culminate in the climax community. For example, ecological succession triggered by fires in Yellowstone Park culminates in pine forests. Pioneer species are the first species to colonize an area after a disturbance occurs. They reproduce quickly and survive in harsh conditions. For example, lichens.</span>
Answer:
weak acid
Explanation:
4-6.9 belongs to weak acids
Answer:
The professor Bonefinder has made a mistake.
Explanation:
I't is true the Hominoid had a long snout, a large orbits that are partially enclosed, but they have no tail. This point is really critical because the morphology of an species is really important. The taxonomists use the information that morphology gave for many years to identify species, nowadays with molecular techniques some of those species are pulled apart, but the important matter is that hominoids had no tail.
So the professor Bonefinder analysis is incorrect because the hominoids have no tail.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
