The inflammatory disease of the central nervous system that attacks the myelin sheath is known as MULTIPLE SCLEROSIS
I hope it helps
If your car is changing speed by accelerating or decelerating, or changing directions by turning or hitting a bump, your body can sense these accelerations. You might be pressed against the back of your seat while speeding up or against the car door as you turn for example. If you are cruising at a constant speed, with no changes in speed or direction, you wouldn't be able to feel it. You would need to use your other senses. You could see the scenery going by through the windows, with closer objects moving by more quickly than objects in the distance. You could also hear sounds like the wind rushing by and the hum of the tires rolling on the highway.
The answer is The Doppler Effect. It is named after the Austrian physicist Christian Doppler, who described the phenomenon in 1842.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.