I've learned that the circulatory system is responsible for transporting nutrients and blood throughout the entire body :D
A food web does not represent all the links in an actual ecosystem.
Explanation:
A food web is also called food cycle. It is understood by the natural interconnection of chain and their graphical representation. The concept is given by Charles Elton. He mentioned about the concept of food cycles in Animal Ecology but later this food cycle is replaced by food web.
Food web are limited representation of eco system. Ecologists can keep together all life forms broadly into one of the two categories which is called tropic levels. These two categories are autotrophs and heterotrophs
Answer:
False
Explanation:
we create more body cells with mitosis not meiosis , we create gametes with meiosis
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
