1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tamiku [17]
3 years ago
11

Question 1 Where does the water cycle begin?

Biology
1 answer:
bezimeni [28]3 years ago
3 0

Answer:

The ocean.

Explanation:

It starts with the ocean and then there is evaporation condensation and precipitation and then runoff.

You might be interested in
How do phagocytes fight pathogenicmicrobes?
Masteriza [31]
They surround and engulf foreign objects and organisms- process called phagocytosis
7 0
3 years ago
Read 2 more answers
Which of the following is a voluntary muscle?
puteri [66]
And involuntary muscle is a muscle you don't have to tell to move, your brain does it by itself so, just look for the opposite.

A)Muscle in your arm
4 0
3 years ago
Which scientist studied the importance of biological determinants on behavior patterns?.
xxMikexx [17]

The significance of biological factors on behavioral patterns was investigated by Konrad Lorenz.

<h3>Biological definition:</h3>
  • 1: of, pertaining to, or involving biology, life, or living processes.
  • 2: a product or usage of applied biology.
  • 3. Rather than through adoption or marriage, her biological father and her are clearly related through dna.
<h3>Why is biology so crucial?</h3>

Biology is a branch of study and aids in our study of how the living world functions, evolves, and interacts with its numerous species, including humans. The quality of life has risen because advances in biology, including in medicine, agriculture, biotechnology, and many other fields.

<h3>What are the three different biological types?</h3>

There are three types of research:

  • Basic,
  • Translational,
  • And applied.

To know more about Biological visit:

brainly.com/question/17196146

#SPJ4

7 0
2 years ago
Which abiotic resource is not likely present in the Texas blind salamander's environment?
Daniel [21]

Answer:

the awnser is c because plants are not likely to present

Explanation:

in texas

5 0
3 years ago
Read 2 more answers
I need at least 2 paragraphs about mars. Thanks for the help!
gladu [14]

Here's it! Good Luck!

Mars is the fourth planet from the Sun and the second-smallest planet in the Solar System, after Mercury. Named after the Roman god of war, it is often referred to as the "Red Planet" because the iron oxide prevalent on its surface gives it a reddish appearance. Mars is a terrestrial planet with a thin atmosphere, having surface features reminiscent both of the impact craters of the Moon and the valleys, deserts, and polar ice caps of Earth.

The rotational period and seasonal cycles of Mars are likewise similar to those of Earth, as is the tilt that produces the seasons. Mars is the site of Olympus Mons, the largest volcano, and second-highest known mountain in the Solar System, and of Valles Marineris, one of the largest canyons in the Solar System. The smooth Borealis basin in the northern hemisphere covers 40% of the planet and may be a giant impact feature. Mars has two moons, Phobos and Deimos, which are small and irregularly shaped. These may be captured asteroids, similar to 5261 Eureka, a Mars trojan.


Hope this helps!
4 0
4 years ago
Read 2 more answers
Other questions:
  • According to cell theory, all cells carry out the functions needed to sustain life. That means all cells must contain A) DNA. B)
    13·2 answers
  • The nurse is caring for a client who had a massive myocardial infarction and developed cardiogenic shock. which clinical manifes
    15·1 answer
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • Why is evolution considered to be one of the most important theories in science?
    6·2 answers
  • Describe the activities that take place in the stroma in bright sunlight and in darkness
    5·1 answer
  • What happens during the light dependent reaction?
    15·1 answer
  • Why is it more important to check for errors during DNA replication than
    13·2 answers
  • A scientist discovers a new type of eukaryotic cell that does not contain mitochondria. As a result of this difference, the scie
    6·1 answer
  • What does 888 mean in angel numbers?
    13·1 answer
  • Which change of state is shown in the model?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!