1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Aloiza [94]
3 years ago
9

Most efficient method of extracting tears from an elderly woman?

Biology
2 answers:
sattari [20]3 years ago
6 0

Answer : Using Opthalmic Sponges.

Explanation : Collecting tears with the trivial methods is often not possible as to avoid the tear reflex is a different problem. Tear collection with glass capillaries are the most widely used method for taking samples and is considered to be the best method for avoiding tear reflex.

To collect tears are from elderly people or small children's who had difficulties with glass capillaries; for them ophthalmic sponges was used.

This kind of opthalmic sponges proved to be well tolerated by the patient, especially in small children's, and also enabled standardization of the tear collection in terms of volume.

kirza4 [7]3 years ago
6 0
I would say that the most efficient method of collecting tears from an elderly woman would be to tell her something very sad that pulled at her heart strings such as say discussing the death of her husband if they had a good relationship and he died a painful death, say, as an example. 
You might be interested in
How do I identify sample, independent and dependent variables?
Mamont248 [21]
A sample is a random, unbiased selection out of a larger group. An independent variable is one that is changed as to see how it will affect the dependent variable in an experiment. 
Hope that helped.
4 0
2 years ago
What factor determines when an animal species will enter an ecosystem in succession? a. minerals b. food availability c. competi
Karolina [17]

The correct answer is (C) competition which determines the succession of an animal in the ecosystem.

<h3>What factors influence when an animal species enters a successional ecosystem?</h3>

Interaction and competition among species in a certain environment is a biotic element of ecological primary succession. When succession begins and the first species, known as pioneer species, alter the environmental structure, new species that are more tolerant of the new conditions move in.

These communities gradually replace one another until a "climax community"—such as a mature forest—is attained or a disturbance, such as a fire, occurs.

Learn more about animal ecosystem refer:

brainly.com/question/842527

#SPJ4

7 0
2 years ago
Why is Dr. Elizabeth Cochrans sensor important to earthquake research? How can it help develop an earthquake warning system?
Mashutka [201]

Answer:

Because Without Earthquake Research Earth Will Be DESTROYED

5 0
2 years ago
Read 2 more answers
HELP I NEED A SCIENTIFIC MODEL AND PARAGHRAPH ABOUT ATOMIC THEROY WILL GIVE BRANLIEST AND POINTS
saveliy_v [14]

<h2>Atomic Theory:</h2><h2>Introduction</h2>

The atomic theory of Atoms Summed up is the idea that all matter is made of tiny particles that are imperceptible to the mortal eye; these particles are named Atoms

<h2>Paragraph 1:</h2>

John Dalton was the first to consider that all matter was made of tiny particles known as atoms. He invented the idea that matter is formed of atoms varying in weight.

<h2>Paragraph 2:</h2>

I created this model of the dissimilarities between three kinds of matter-- solids, liquids, and gases. The distance between atoms in each state tells us what type of matter we observe.

The Drawing is on the file

The End.

I hope you found this helpful

8 0
2 years ago
Can you PLEASE HELP ?!
Lapatulllka [165]

Answer:

fish

Explanation:

abc one two three

4 0
3 years ago
Other questions:
  • Unlike us humans, bacteria reproduce only by mitosis (not meiosis). What would
    13·1 answer
  • Cell membranes have each of the following functions EXCEPT-
    11·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • 1. DULU-maple forest
    7·1 answer
  • You are analyzing a compound in a laboratory. You find that it is made up of carbon, hydrogen, and oxygen in a ratio of two hydr
    7·2 answers
  • Endangered species are a concern to conservationists because there’s a risk that the animals won’t be able to adapt to their env
    9·2 answers
  • Which is true about cold fronts?
    10·2 answers
  • Could someone please come help me
    11·2 answers
  • Which of the following provides evidence for past tectonic plate motions? *
    10·1 answer
  • For each molecule of glucose that is processed by glycolysis and the citric acid cycle, what is the total number of nadh fadh2 m
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!