1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aev [14]
4 years ago
8

As light passes through a prism, which color will bend most

Biology
1 answer:
Sauron [17]4 years ago
3 0
<span>VIOLET
</span>Red light has a longer wavelength than violet<span> light. The refractive index for red light in glass is slightly different than for </span>violet<span> light. </span>Violet<span> light slows down even more than red light, so it is refracted at a slightly greater angle</span>
You might be interested in
List three organisms transported by ocean currents.
alekssr [168]
Many ocean species (especially large ones like whales, sharks, and sea turtles) follow ocean currents to and from their feeding and breeding grounds.
4 0
4 years ago
Can someone help match these defenitions.
luda_lava [24]

The right matches are:

1. nuclear envelope  is matched with b.

2.centriole  is matched with  a.

3.interphase is matched with j.

4.furrowing  is matched with h.  

5.anaphase  is matched with g.

6.spindle apparatus is matched with f.

7.chromatin is matched with i.

8.haploid is matched with c.

9.meiosis is matched with e.  

10.homologous chromosomes is matched with d.


Cell division consists of the formation of two or more cells from a single cell, which ensures their numerical growth. During mitosis of a cell, each daughter cell is identical to the mother cell. During meiosis, the mother cell gives two haploid daughter cells with n chromosomes, then each of these daughter cells give two n chromatid cells.

May be some word in this exercise are not very common like:

The mitotic spindle, allows chromatid migration during cell division.

The dividing groove is the invagination of the cell surface that allows the cell to divide in two.

Centriole is a specific cell element of animal cells, which form the centrosomes located at both poles of the cell.


8 0
3 years ago
You have learned that mutations can occur in dna sequences. are all mutations deadly?
Monica [59]
No, the vast majority of DNA mutations are not physically noticeable, and those that are noticeable physically are mainly cosmetic differences, such as a change in hair color, or heterochromia. 
3 0
3 years ago
Is C2 considered a molecule or a compound?
mina [271]
Goat Pennis                                                                                                                                                                                                                                                          ddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddddd 
3 0
3 years ago
Read 2 more answers
What is the probability that each of the following pairs of parents will produce the given offspring: 1. AABbCc x aabbcc à AaBbC
ICE Princess25 [194]

Answer:

1) AaBbCc, 50% - 2) AAbbCC, 3,125% - 3) AaBbCc is 12,5%.

Explanation:

<u>1º cross</u>.

Parental)          AABbCC             x               aabbcc

Gametes)   ABC   AbC   ABC    AbC    ABC    AbC    ABC    AbC

                   abc    abc   abc     abc      abc     abc     abc     abc

Punnet Square)   <em>Only filled with the progeny genotype AaBbCc</em>.

             ABC       AbC       ABC       AbC         ABC      AbC         ABC     AbC

abc      AaBbCc     ---      AaBbCc     ---         AaBbCc     ---        AaBbCc    ---  

abc      AaBbCc     ---      AaBbCc    ---         AaBbCc     ---        AaBbCc    ---  

abc      AaBbCc     ---      AaBbCc     ---         AaBbCc     ---        AaBbCc    ---  

abc      AaBbCc     ---      AaBbCc     ---         AaBbCc     ---        AaBbCc    ---  

abc      AaBbCc     ---      AaBbCc     ---         AaBbCc     ---        AaBbCc    ---  

abc      AaBbCc     ---      AaBbCc     ---         AaBbCc     ---        AaBbCc    ---  

abc      AaBbCc     ---      AaBbCc     ---         AaBbCc     ---        AaBbCc    ---  

abc      AaBbCc    ---      AaBbCc     ---         AaBbCc     ---        AaBbCc    ---  

   

F1 Genotype)    32/64 AaBbCc

                          32/64  AabbCc (shown as the symbol "---" in the      

                          punnet square)

The probability of producing offspring with genotype AaBbCc is 50%.

---------------------------------------------------------------------

<u>2º cross.</u>

Parental)          AABbCc            x               AaBbCc

Gametes)   ABC   ABc   AbC    Abc    ABC    ABc    AbC    Abc

                     ABC   ABc   AbC     Abc   aBC    aBc     abC    abc

Punnet Square)   Only filled with the progeny genotype AAbbCC.

          ABC    ABc      AbC      Abc     ABC     ABc     AbC       Abc

ABC      ---       ---          ---          ---        ---        ---          ---           ---  

ABc       ---       ---          ---          ---        ---        ---          ---           ---  

AbC       ---      ---    AAbbCC     ---       ---         ---     AAbbCC    ---  

Abc       ---       ---          ---           ---       ---        ---          ---           ---

aBC       ---      ---          ---           ---        ---       ---          ---           ---  

aBc       ---       ---          ---           ---        ---       ---          ---           ---  

abC      ---       ---          ---           ---        ---        ---          ---          ---  

abc       ---       ---          ---           ---        ---        ---          ---          ---

   

F1 Genotype)  2/64 AAbbCC

                       The rest of the progeny have different genotypes that are represented with the symbol "---" in the punnet square.

The probability of producing offspring with genotype AAbbCC is 3,125%.

--------------------------------------------------------------------

<u>3º cross.</u>

Parental)          AaBbCc            x              AaBbCc

Gametes)   ABC   ABc   AbC    Abc    aBC    aBc    abC    abc

                     ABC   ABc   AbC    Abc    aBC    aBc    abC    abc

Punnet Square)   Only filled with the progeny genotype AaBbCc.

          ABC       ABc       AbC       Abc      aBC     aBc       abC       abc

ABC      ---           ---          ---           ---         ---        ---           ---      AaBbCc    

ABc       ---           ---          ---           ---         ---        ---      AaBbCc     ---  

AbC      ---           ---           ---          ---          ---    AaBbCc    ---           ---  

Abc       ---           ---           ---          ---     AaBbCc  ---           ---           ---

aBC       ---           ---           ---     AaBbCc    ---         ---          ---           ---

aBc       ---            ---       AaBbCc   ---          ---        ---           ---          ---  

abC      ---       AaBbCc      ---          ---          ---        ---           ---          ---  

abc   AaBbCc       ---            ---       ---           ---        ---           ---          ---

   

F1 Genotype)  8/64 AaBbCc

                       The rest of the progeny have different genotypes that are represented with the symbol "---" in the punnet square.

The probability of producing offspring with genotype AaBbCc is 12,5%.

7 0
3 years ago
Other questions:
  • Which best describes the structure of DNA?
    7·1 answer
  • Please help ASAP! Picture
    5·1 answer
  • Natural selection acts directly on an organisms's
    10·2 answers
  • Look at the picture below.
    13·1 answer
  • Why do scientists believe that warm climates provide greater biodiversity.
    9·2 answers
  • David and his lab partner are dissecting an earthworm during biology lab. They are cutting the earthworm with a scalpel in order
    8·2 answers
  • An organism’s niche is determined by its ,______ which is it’s physical environment
    8·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Please help asap tysmm &lt;3333
    5·1 answer
  • What do u mean by the term inflorescence ?<br>Thank you​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!