1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sindrei [870]
3 years ago
14

A mutation occurs such that a spliceosome cannot remove one of the introns in a gene. What effect will this have on that gene?

Biology
1 answer:
Ivenika [448]3 years ago
6 0

Answer:

Translation is the process by which protein product will form from the RNA molecule with the help of enzymes and protein. The three important process of translation are initiation, elongation and termination.

The mutation that prevent the removal of spliceosome from the intron, the introns will reside within the exons. The translation of this type of RNA a non dunctional protein product can be formed due to the insertion of the introns within the exon sequence.

You might be interested in
TUECOLOR
irina1246 [14]
I think it’s D

Explanation:

Primary consumers are herbivores, feeding on plants. Caterpillars, insects, grasshoppers, termites and hummingbirds are all examples of primary consumers because they only eat autotrophs (plants). There are certain primary consumers that are called specialists because they only eat one type of producers.
3 0
2 years ago
Read 2 more answers
When a tapeworm steals nutrients from the gut of a mammalian host, that symbiosis is called?
Umnica [9.8K]
Tapeworms are known to feed off of their hosts to complete their life cycle. This type of symbiotic relationship is called parasitism. Parasitism is defined as the type of symbiotic relationship wherein only one of the two interacting organisms benefit, at the latter organism's expense. Parasites could either be found inside or outside the host's body. Tapeworms are internal parasites. 
3 0
3 years ago
7. When two or more species live together in a close, long-term relationship, it is called
alisha [4.7K]
7: symbiotic relationship
8: mutualism 
9: commensalism  

8 0
3 years ago
How do ecologists define an ecosystem?
Free_Kalibri [48]

Answer:

An ecosystem consists of all the organisms in an area, the community, and the abiotic factors that influence that community. Ecosystem ecologists often focus on flow of energy and recycling of nutrients. Biosphere: The biosphere is planet Earth, viewed as an ecological system.

7 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Other questions:
  • Imperfect fungi only reproduce sexually. True or False
    13·1 answer
  • What type of cells are able to go through the process of cell differentiation? Where can you find each of these types of cells?
    12·1 answer
  • True or false mutations can be genetically inherited
    6·1 answer
  • How is transcription different from DNA replication? How is it similar? It tranfered proteins
    8·1 answer
  • CORRECT ANSWER PLEASE!!
    10·1 answer
  • How are oxygen and carbon cycled between plants and animals?
    14·2 answers
  • Why are light intensity, carbindioxide concentration and temperature are limiting factors?​
    14·1 answer
  • Similarities among vertebrate embryos suggest evolution from a common ancestor. * True or False?​
    8·1 answer
  • What is the evidence that warmer water temperature is an environment factors influencing the growth of a species
    11·1 answer
  • 5 sentences each help me please
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!