1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olga55 [171]
3 years ago
10

When you exercise explain why both your heart rate and breathing rates increase?

Biology
2 answers:
S_A_V [24]3 years ago
8 0
This is because during this processes, one's body requires more oxygen to function.
Vikentia [17]3 years ago
4 0

Your heart speeds up to pump extra food & oxygen the muscles.

Breathing speeds up to get more oxygen & to get rid of more carbon dioxide.

You might be interested in
India has two very fertile ______ valleys created by the Ganges River and the Indus River.
Mandarinka [93]
I believe it's River Valley's
I hope this helps
<span />
4 0
3 years ago
How are Dolly and STEM cells related?
Mamont248 [21]

Search it up on google

7 0
3 years ago
Read 2 more answers
What is the function of bacteriophage​
marusya05 [52]

Answer:

A bacteriophage attaches itself to a susceptible bacterium and infects the host cell. Following infection, the bacteriophage hijacks the bacterium's cellular machinery to prevent it from producing bacterial components and instead forces the cell to produce viral components.

Explanation:

4 0
3 years ago
Explain why two oxygen atoms bond to a carbon atom to make a stable molecule of a carbon dioxide?
Sergio039 [100]

Answer:

The answer to your question is:

Explanation:

When carbon attached to oxygen, they form covalent bonds, in these kind of bonds, atoms share electrons to acquire stability.

Atoms acquire stability when they have 8 electrons in their outermost shell.

When carbon share electrons with oxygen they acquire 8 electrons and they are stable.

See the picture below

Red is carbon and blue oxygen

8 0
3 years ago
In the Northern Hemisphere, a wind blowing from the south to the north will cause a current of water in which direction?
miskamm [114]
The direction will be East.
6 0
2 years ago
Read 2 more answers
Other questions:
  • Which of the following energy sources are most available at the edges of tectonic plates?
    11·1 answer
  • How are species related to the concept of biodiversity
    14·1 answer
  • A plant leaf is constructed from a variety of cell types with specialized structures and functions. Many of the properties of le
    5·1 answer
  • Which type of fibers are found in the hypoglossal nerve (cn xii)?
    14·1 answer
  • In which case would a scientist choose to use a dissecting microscope rather than a compound
    5·1 answer
  • The failure of the attempt to reintroduce clapper rails in California was an example of the _____.
    10·1 answer
  • 6. How might a disturbance in a food web impact other organisms in the marine<br> environment?
    11·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • _____ cells do not have any membrane bound organelles but they do have a nucleus
    12·1 answer
  • Which statement is most likely to represent the way the society in the picture
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!