1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lana66690 [7]
3 years ago
12

In dna replication, the helix he opened and unwound by the enzyme dna

Biology
1 answer:
bonufazy [111]3 years ago
7 0

The helicase is what spits open the DNA.

You might be interested in
According to Moh's hardness scale, your fingernail would be rated as 2.5. Juan and Carol are trying to identify an unknown miner
Elan Coil [88]
I think it's B., calcite.

Not sure though.

Hope this helps, 
-Tiara
5 0
3 years ago
Read 2 more answers
What is indicated by two species having similar amino acids in the hemoglobin protein?
Anna71 [15]
Answer: The two species were Rhesus monkey and Human <span>
Hemoglobin protein is the iron containing protein found in the red blood cells which function by transporting oxygen through the blood stream from from the lungs to the tissues and it is important for survival. However, the  two species that have similar amino acids in the hemoglobin protein were Rhesus monkey and Human because they were not far from others.</span>
3 0
3 years ago
If an island had 1000 cats on it, an ecologist would use the word _______ to describe all the members of that species
WINSTONCH [101]
<span>If an island had 1000 cats on it, an ecologist would use the word 'population' to describe all the members of that species</span>
8 0
3 years ago
Which normal cell characteristic is represented by the production of insulin in the beta cells of the pancreas? Select one: a. C
pychu [463]
Insulin is produced by beta cells of the pancreas for storing and disposing of the glucose in various parts of the body like liver. This activity is a differentiated function of the beta cells of pancreas only. Although gene for insulin production is present in all cells, it is expressed only in the beta cells. Hence, it is a differentiated function.
4 0
3 years ago
Which of the following does not explain why if two people are exposed to the same high stress causing conditions, there is a lik
e-lub [12.9K]

Answer:

Probably B

Explanation:

They all explain it, honestly, but B sounds the least like an answer they would accept as true. It's also kind of sus that they have 2 different answers about reacting differently to stress, and B is definitely the least likely of the two to be correct. Sorry I couldn't be more helpful, I'm only here because I searched for the answer myself. Good luck.

8 0
3 years ago
Other questions:
  • Mitochondria contain their own genes. study of these genes has revealed that mitochondria can be inherited from both the mother
    8·1 answer
  • 1º) O que é genética? Quem é considerado o "pai" da genética? 2º) Defina cada um com conceitos: a) GENE b) DNA c) RNA/FUNÇÃO d)
    11·1 answer
  • PLEASE HELP ME Which of the following codes for a specific protein? DNA gene enzyme chromosome Which of the following is single-
    9·2 answers
  • Do bacteria have nuclei
    14·2 answers
  • Which of the following is considered a modified stem?
    8·1 answer
  • what type of stimulus is a seed responding to when it begins to sprout? A. Hormones B. Lack of soil C. Sunlight D. Cold temperat
    14·1 answer
  • Consider how lettuce or spinach placed in water becomes firm and crisp. Use what you have learned about cell membranes to explai
    12·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Why do organisms have different niches?​
    12·1 answer
  • Please help I don't understand ​
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!