1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anastaziya [24]
3 years ago
7

The difference in the concentration of a substance from one location to another is called a

Biology
1 answer:
Amanda [17]3 years ago
8 0

Answer:

Concentration gradient

Explanation:

The larger the difference in concentration of the molecules between the two locations, the higher the concentration gradient. The system is therefore referred to as having a high Free Gibbs Energy (and  low entropy), which is the potential energy intrinsic of the system to do work.  Therefore, it will be spontaneous that the molecules will want to move from the location of higher concentration to the location of lower concentration until equilibrium is achieved (process called difussion).

You might be interested in
Im stuck! Please help
Mademuasel [1]

When it is winter in the Northern Hemisphere, the Southern Hemisphere faces the Sun more directly and thus experiences warmer temperatures than the Northern Hemisphere. Meaning that the date is June 21- summer

6 0
3 years ago
Assume the gene for freckles is dominant (f). a woman with freckles has a son that does not. what would have to be the genotype
stiks02 [169]
She would be heterozygous. 
6 0
3 years ago
Large multicellular organisms are made of a wide variety of cell types. Do
Murrr4er [49]

Answer:

Yes, All of the cells divide at approximately the same rate, although they may divide at different times

7 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
2 years ago
If an ecosystem has only enough food for 100 people and 20 horses, when the population increases to 200 people, 30 horses, and t
Tamiku [17]
The answer is D. Food Threshold is the amount of food capable on feeding the organisms.
4 0
3 years ago
Other questions:
  • Give examples of how carbon returns to our atmosphere and water?
    11·1 answer
  • inferring birds such as darwins finches are adapted to occupy highly specific niches. would this adaptation make it easy or diff
    13·2 answers
  • Submarine canyons are usually found in which region?
    5·1 answer
  • Blank. the kingdom of yeast, mold and mushrooms
    9·2 answers
  • Provide a specific example of photosynthesis and cellular respiration working together.
    13·1 answer
  • If blood flow through the afferent arterioles increases:
    9·1 answer
  • Describe the sodium potassium pump using as much detail as possible. Bonus if you can accurately describe how this relates to cy
    12·1 answer
  • A student collected the animal shown below on a field trip. The student used a dichotomous key and a microscope to classify the
    10·1 answer
  • Please help worth 95 points. Project: Algae Cultures: Directions
    10·2 answers
  • How could coffee being spilled affect the thermal energy transfer of her coffee
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!