Explanation:
carbohydrates, lipids and proteins are the type of biomolecules used to convert energy to ATP,
hope it is helpful to you
Answer: This modern-day researcher used some of the same theories that Darwin proposed. Like Darwin and his finches and tortoises, this scientist understood that the Galapagos cormorants inherited flightless wings. Darwin eventually discovered that his Galapagos finches likely evolved from other species of finches on the mainland. This evolution was similar to how the flightless Galapagos cormorants evolved from other species of cormorants.
Explanation:
Homeostasis is a property of an organism or system that allows its to maintain the controlled parameters within normal ranges. Henry Barbour contributed to the understanding of this concept by his delineation of the reactions of the temperature of the body. This is in line with the same concept that was initially proposed by Claude Bernard.
Answer:
The environment that it lives in has not changed much, therefor there is no need for evolution to take place.
Explanation:
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
