1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
marishachu [46]
3 years ago
9

Please help me, please

Biology
2 answers:
kakasveta [241]3 years ago
7 0
With what?? Please comment to me if you need anything
Elden [556K]3 years ago
6 0

Answer:with what

Explanation:

You might be interested in
Which of the following is extrusive? <br><br>Magma <br>Lava <br>Laccolith <br>Batholith
tangare [24]
The answer to which of the following is extrusive is letter B. lava
3 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
How many chromosomes will this daughter cell have?
eimsori [14]

Answer:

Answer: 10 Chromosomes

7 0
3 years ago
¿Cómo se produce la Hepatitis B?
guapka [62]

La hepatitis B es un virus, una infección de su hígado. Puede causar cicatrización del órgano, insuficiencia hepática y cáncer.

8 0
3 years ago
Which organisms can cause contagious deceases?
jekas [21]
Protozoans, bacteria, fungi... viruses are not organisms
5 0
3 years ago
Other questions:
  • A laccolith is an example of a(n) ____igneous rock (one of the two main igneous rock groups).
    5·2 answers
  • Which type of muscle can be found inside organs
    5·1 answer
  • The nerves that control voluntary responses like those connected to your muscles are part of the _____ nervous system.
    5·2 answers
  • Analyze the need for laws to control water resources ,and compare water rights doctrine in the eastern U.S to that of the wester
    13·1 answer
  • Where does the first stage of cellular respiration, glycolosis, occur? A. cell cytoplasm B. mitochondrial matrix C. mitochondria
    15·2 answers
  • Can someone help me with this science diagram
    10·1 answer
  • Need help with this.
    10·1 answer
  • Help pls thx will give brainlyest
    15·2 answers
  • One thing that is not a factor in determining critical mass is
    9·1 answer
  • Im doing an experiment with Brine shrimp and I am confused how to set up the experiment and the data table. The experiment is to
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!