1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatiyna
3 years ago
6

Select all that apply.

Biology
2 answers:
Effectus [21]3 years ago
7 0

Answer:

oxygen moves from the alveoli to the blood .  the secound option

Explanation:

thats it <3

yawa3891 [41]3 years ago
3 0
Last one: blood going to the cells receives co2
You might be interested in
When a cell has reached its maximum size, what two alternatives does it have? When does the cell carry out one alternative over
nataly862011 [7]
It can either undergo mitosis or function as a unicellular body.
hope this helps


4 0
3 years ago
Read 2 more answers
Which of the following is an advantage of sexual reproduction over asexual reproduction? I. Sexual reproduction is more rapid an
weeeeeb [17]
The answer is II.Sexual reproduction results in more diversity
5 0
3 years ago
Read 2 more answers
Why are fossil fuels considered nonrenewable resources if they are still forming?
Leni [432]

Answer:

a

Explanation:

Fossil fuels are considered non renewable because they take millions of years to form but depleted faster than they are formed.

6 0
3 years ago
What could happen if negative feedback inhibition did not signal the pancreas to stop producing insulin and blood sugar levels d
SCORPION-xisa [38]

Answer:

If the pancreas did not stop producing insulin and blood sugar levels did not dropped to normal levels so it causes a disease called hyperinsulinemia. This disease causes heart disease and cancer in the body. With increased levels of insulin makes the cells resistant to harmone which means there is no effects of harmone on the cell and the body didn't perform its functions properly. The increase in insulin levels increase the absorption of sugar from the blood and the person gets more weight which is not good for health.

5 0
3 years ago
Aerobic respiration occurs in the presence of?
weqwewe [10]

Answer:

Oxygen.

Explanation:

Aerobic respiration occurs in the presence of oxygen.

7 0
3 years ago
Other questions:
  • Which of the following factors contributes to reemergence of disease more than the appearance of a new disease?
    6·2 answers
  • Which sentence describes energy flow through a natural (not manufactured) system?
    15·2 answers
  • What helps identify cell types
    7·1 answer
  • FILL IN THE INFORMATION BELOW with the correct sequence
    13·1 answer
  • A removal of a dam in a river has restored river flow and improvedthe water quality of the river. Which of these would most dire
    11·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • A scientist noted that the number of American crocodiles in a community had
    15·2 answers
  • Josiah says this is a phylogenetic tree of the dinosaurs. maleek says it is a cladogram of the dinosaurs. who is correct?
    6·1 answer
  • What is Uranium’s atomic number
    13·2 answers
  • Use Fractions
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!