1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Juliette [100K]
3 years ago
11

Justify your answer by filling in the blanks. Both parents have white fur. way that this can happen is if their genotypes are bo

th . Therefore, both parents pass the allele to every offspring. When you combine two of these alleles, the resulting genotype is ; therefore, the resulting offspring have white fur.
Biology
2 answers:
zalisa [80]3 years ago
6 0

Answer:

the only

bb

b

bb

Explanation:

MissTica3 years ago
3 0

Answer:

Both parents have white fur. <em>The only</em> way that this can happen is if their genotypes are both <em>homozygous (bb)</em>. Therefore, both parents pass the (b) allele to every offspring. When you combine two of these alleles, the resulting genotype is <em>(bb);</em> therefore, the resulting  offspring have white fur.

Explanation:

A homozygous trait can be described as a trait in which both the alleles for a gene are similar. A heterozygous trait can be described as a trait in which both the alleles of a gene are different. If an allele masks the effect of another allele, it is said to be dominant. the allele that gets suppressed is termed as recessive.

Hence, for a recessive trait to occur both the alleles of a gene should be homozygous recessive.

The punnet square for the above cross is shown below:

        b       b

b       bb     bb

b       bb      bb

You might be interested in
A black erminette chicken is crossed with a white erminette chicken. what color are the offspring
NeTakaya
They could be white or black. Black should be dominant, I guess, so 75% of offspring should be black.
8 0
3 years ago
The above picture represents the different stages a cell goes through in its "ufetime Each phase is characterized by specific ev
Masteriza [31]

Answer:

drvwtgbui

Explanation:

hyuiofy7fd

6 0
3 years ago
What is chlorine and what is the atomic number
atroni [7]
Chlorine-the chemical element of atomic number 17, a toxic, irritant, pale green gas

atomic number-the number of protons in the nucleus of an atom, which determines the chemical properties of an element and its place in the periodic table.
6 0
3 years ago
In Table 9-1, explain the way that ammonia, salt, and water are alike.
baherus [9]
There exists the same question from other source that has the table;

The information in the table are as follows:
Ammonia - NH3
Glucose - C8H12O6
Salt - NaCl
Water - H2O

Ammonia, salt and water are alike because, first they are all compounds. They are composed of two different atoms: Ammonia - N and H, Salt - Na and Cl, Water - H and O
4 0
4 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Other questions:
  • One example of ecological interaction in the ocean is the relationship between boxer crabs and sea anemones. In this unique rela
    7·1 answer
  • Which of the following are the three kinds of RNA? A. rRNA, dRNA, mRNA B. rRNA, mRNA, tRNA C. iRNA, mRNA, sRNA D. tRNA, dRNA, rR
    14·2 answers
  • When one DNA molecule is copied to make two DNA molecules, the new DNA
    7·2 answers
  • The majority of Earth's atmosphere is nitrogen, N2. The percentage of nitrogen in Earth's atmosphere remains constant as prescri
    15·1 answer
  • 20 PTS!!!+ PROMISING BRAINLIEST Why are coral reefs given the nickname “rain forests of the sea”?
    8·2 answers
  • The light reactions occur in the ________, while the Calvin cycle occurs in the ________. stroma . . . thylakoid membranes strom
    6·1 answer
  • How many sperm cells are formed from an original cell in a Drosophila fruit fly at the conclusion of meiosis?
    9·1 answer
  • Sub atomic particles found in protons and neutrons are what?
    7·2 answers
  • Which process produces the sediments that ultimately lead to soil formation?
    7·1 answer
  • Enzymes end in ase or in. what substances/ macromolecules do you think the following enzymes break down?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!