1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
slega [8]
3 years ago
5

The final shape of a protein is determined by the sequence of its amino acid residues. What determines this amino acid sequence?

Biology
2 answers:
exis [7]3 years ago
8 0

it is determined by a sequence of DNA that is in the gene, and for the resulting is mRNA

OlgaM077 [116]3 years ago
8 0

Answer:

What determines the amino acid sequence of a protein is the sequence of nitrogenous bases in DNA.

Explanation:

We know that proteins, substances essential for the functioning of the body, are a set of amino acids that are linked together by peptide bonds. The amino acid sequence of a protein will be determined by the arrangement of nitrogenous bases in an mRNA. This, in turn, will be produced from a DNA molecule. We can say, therefore, that DNA provides the information for the production of proteins.

The genetic code can be defined as the relationship between the cracks (codons) found in the mRNA and the amino acids found in a protein. Codons are cracks formed by nitrogenous bases (A, U, C and G).

The four nitrogenous bases can have 64 different combinations, therefore, there are 64 different codons. Of these codons, 61 will encode the 20 different types of existing amino acids. The other three codons (UAA, UAG and UGA) will be responsible for indicating the places where the synthesis ends, and are also called stop codons. They do not encode any amino acids and are not read by tRNA, but by proteins called release factors.

You might be interested in
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
Which of these are considered an oxidizing mutagenic agent?
kherson [118]
Benzopyrene. Is the correct answer
5 0
3 years ago
Question 15<br> What does DNA do in living things?
myrzilka [38]

Answer:

Deoxyribonucleic acid (DNA) is a nucleic acid that contains the genetic instructions for the development and function of living things. All known cellular life and some viruses contain DNA. ... The major function of DNA is to encode the sequence of amino acid residues in proteins, using the genetic code.

Explanation:

4 0
3 years ago
Read 2 more answers
Which client is at the risk for decreased sexual functioning?
Westkost [7]
The secretary is at risk for decreased sexual function that's the answrb
8 0
3 years ago
What is the normal cardiovascular response to early sepsis.
miskamm [114]

Ronaldo is the goat

7 0
2 years ago
Read 2 more answers
Other questions:
  • What are the strengths and limations of your model
    10·1 answer
  • What type of relationship is between remora and a shark?
    5·1 answer
  • Rattlesnake fern, or Botrychium virginianum, as shown below, is a species of fern, a seedless plant, that is found all across No
    11·2 answers
  • This hypothetical pedigree for a disease in humans illustrated inheritance that is
    7·1 answer
  • What is the relationship between tissues and organs​
    10·2 answers
  • Describe the typical principles used to identify topogenic sequences within proteins and how these principles can be used to dev
    12·1 answer
  • Which activity causes the least amount of wetland and estuary degradation when it occurs near the coast?
    14·1 answer
  • Which of the following is used to provide energy in animal cells?
    13·2 answers
  • Immense characteristics ?
    15·1 answer
  • Dna sequencing suggests that among the green algae, the __________ are most closely related to land plants.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!