1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
telo118 [61]
3 years ago
14

You are studying an individual with very low levels of insulin in her blood. Further analysis indicates that cells of her pancre

as are producing normal levels of this protein, but it is accumulating in the cytoplasm rather than being secreted from the cells. Which hypothesis makes the most sense to explain this observation?
Biology
1 answer:
Darina [25.2K]3 years ago
8 0

Answer:

a small deletion occurs in the nucleotide sequence at the aminoterminal of the gene in the signal sequence

Explanation:

A  deletion in the sequence of nucleotide that code for the  small signal sequence responsible will affect the release of insulin outside the cells because the signal sequence is responsible for carrying the insulin outside the cells. The cells of pancreas are producing the insulin normally but due to mutation in the signal sequence it can not  release out of the cells and accumulate inside the cells.

You might be interested in
The heart lies in the thoracic cavity between the lungs in an area called the
pychu [463]
The heart lies in a chest cavity known as the Mediastinum
5 0
3 years ago
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
Elden [556K]

Answer:

Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.

Codons before mutation:  ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

Explanation:

Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.

The Sequence before mutation ATGCTGCGAAACTTTGGCTGA

Codons: ATG   CTG   CGA   AAC   TTT   GGC   TGA

The Sequence after mutation ATGTGCGAAACTTTGGCTGA

Codons: ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

4 0
3 years ago
Which brain structure maintains homeostasis and influences blood pressure, heart rate, digestive activity, breathing rate, and b
Iteru [2.4K]
The answer is A.hypothalamus
8 0
3 years ago
Explain how diffusion allows the small intestine
Black_prince [1.1K]

Answer:

because smaller is better i would knoow

Explanation:

6 0
2 years ago
In the transition from rest to moderate exercise, ________________ supplies almost all of the energy. A) glycogen stored in the
zaharov [31]

Answer:

glycogen stored in the liver

6 0
3 years ago
Other questions:
  • Which of the the following is NOT part of a nucleic acid? A.) phosphate B.) 5-carbon sugar C.) nitrogen ousted base D.) Amino ac
    14·2 answers
  • Sometimes metamorphic rock is found adjacent to an igneous intrusion, as shown in the drawing. according to geologists, what cau
    7·2 answers
  • The deadliest of all mass extinctions, which killed 95% of all living organisms, was the _____.
    10·2 answers
  • Which would function MOST EFFECTIVELY as a concluding sentence?
    10·2 answers
  • Explain the difference between crossing over and genetic variation
    7·1 answer
  • Plz help!!!!!!!
    5·1 answer
  • Which protist is the most widely known form of marine plankton and is thought to have given rise to plants?
    14·1 answer
  • Three types of _____ tissue are skeletal, smooth, and cardiac.
    8·2 answers
  • O albinismo é uma anomalia de caráter recessivo que se caracteriza pela ausência de melanina na pele. Um casal de genótipo heter
    5·1 answer
  • What 2 properites are needed to figure out the effect of a force on acceleration of an object?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!