1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mariana [72]
3 years ago
13

In what way is ecology part of environmental science

Biology
1 answer:
Masja [62]3 years ago
6 0
Ecology is environmental science. 
<span>Ecology- the branch of biology that deals with the relations of organisms to one another and to their physical surroundings.
    Hope this helps!</span>
You might be interested in
with regard to enzymes, what can be said to the relationship between the substance and the active site?
77julia77 [94]
The substrate and the active site both need to fit together perfectly in order for the enzyme to work properly. If their shape is changed, typically through heat or a change in pH, the enzyme will not work.
7 0
3 years ago
Read 2 more answers
A random-digit dialed survey conducted in the city of long beach, california reported that a greater proportion of nonsmokers en
djyliett [7]

Answer:

The correct answer is case-control study.

Explanation:

In a case-control study, two groups of the population are used, in which one group is kept as control, and the other is known as the experimental group that encounters with a specific disease or an outcome. With the help of this study, one can expose the groups to various or single outcomes.  

In the given case, a study is done in which an advertisement on a ban on smoking is encouraged by the non-smokers at the alcohol sale points but not by smokers, in the process a random digit dialing method was used. This random digit dialing method is an illustration of a case-control study, in which the survey of the individuals is done regarding the ban on smoking.  

8 0
3 years ago
How does a hypothesis help science understand the natural world?
Pachacha [2.7K]
It can help show what people believe or understand about the natural world.
4 0
3 years ago
In a separate location, take notes from the sources you have identified. The notes will provide details for your paper. While ta
bezimeni [28]

Answer:

- The american male BullDog can weigh up to 75-100 pounds while the female bulldog can weigh up too 60 to 80 pounds.

- The Life expectancy of a american Bulldog can be up 10-12 years.

- Generally the American Bulldog skin is 52 to 70 centimeters, but it can go overboard.

- The American Bulldog barking can be up 80-90 decibels.

Explanation:

3 0
3 years ago
Which bodily system is involved with the secretion of hormones?
liubo4ka [24]
Endocrine system is involved in this
8 0
3 years ago
Other questions:
  • (01.01 MC)
    14·1 answer
  • In comparing photosynthesis and cellular respiration, which of the following is TRUE?
    8·2 answers
  • The harp seal lives on the polar ice sheets. Which adaptation makes it best suited for this environment?
    8·1 answer
  • The organisms in a community are independent. what does this mean?
    5·1 answer
  • A rectangle 10 ×9×18 surface area<br>​
    5·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Why do innie belly buttons pop out during pregnancy, but not weight gain?
    12·1 answer
  • What's solid layer of rock beneath soil
    11·1 answer
  • How do secondary consumers help the ecosystem?<br><br> Please help ASAP
    10·1 answer
  • 47. This cladogram shows the evolutionary relationships among some mammals
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!