1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lady bird [3.3K]
3 years ago
9

Drag the terms to their correct locations in the paragraph. Not all terms will be used. ResetHelp genomics genetic engineering H

uman Genome Project genomes proteins whole-genome shotgun The was a massive scientific undertaking meant to identify and sequence all of the genes found In a human cell. This is just one example of , the branch of biology that studies whole , which are the complete sets of DNA found within organisms. One of the interesting conclusions from this project was that only about 1.5% of human DNA encodes for . Although it was groundbreaking for its time, it is now fairly routine to completely sequence the DNA of an organism using the method. In this method, the DNA is chopped up with restriction enzymes, the fragments are sequenced, and then they are reassembled into one continuous sequence. Through such analyses, scientists are learning much about human DNA and its relation to other species.
Biology
1 answer:
Nata [24]3 years ago
4 0

The Human Genome Project was a massive scientific undertaking meant to identify and sequence all of the genes found In a human cell .

This is just one example of genomics, the branch of biology that studies whole genomes, which are the complete sets of DNA found within organisms. One of the interesting conclusions from this project was that only about 1.5% of human DNA encodes for proteins. Although it was groundbreaking for its time, it is now fairly routine to completely sequence the DNA of an organism using the whole-genome shotgun method. In this method, the DNA is chopped up with restriction enzymes, the fragments are sequenced, and then they are reassembled into one continuous sequence. Through such analyses, scientists are learning much about human DNA and its relation to other species.


You might be interested in
True Or False!....SUCROSE MOLECULES BREAK DOWN DURING CELLULAR RESPIRATION
nirvana33 [79]
The answer is: False

4 0
4 years ago
Calcium sulfide forms when calcium loses 2 valence electrons to sulfur. What type of a bond is formed? covalent ionic
il63 [147K]
A covalent bond is formed
4 0
3 years ago
Scientists know that some methods used to increase food supply are dangerous to humans. Which method is known to be harmful to h
kap26 [50]
Chemical method is harmful
4 0
3 years ago
Read 2 more answers
Use the Transcription Translation interactive to answer the question. Arrange the amino acids coded for in the translation porti
skelet666 [1.2K]

Answer:

Given as thus below :

Explanation:

Leusine

Histidine

Glycine

Methionine

Glutamine

Arginine

4 0
3 years ago
What made Darwin
Ket [755]
When a tourist told him that each turtles look different on the island
4 0
4 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Messages from the brain to the muscles and glands in the body begin their journey in the __________.
    6·1 answer
  • *blank* harvesters have replaced hand labor in many agricultural fields
    6·1 answer
  • The line between the footprints in the upper left hand corner, is the animals what?
    12·1 answer
  • True or False: If a cell moves pass the M phase checkpoint this means that the DNA chromosomes are not correctly aligned in the
    11·1 answer
  • Compose a three to five-sentence paragraph that discusses reasons Hannibal could use to convince his friend that mushrooms are f
    7·1 answer
  • many promoters of a hypothetical conserved gene have mostly adenines and thymines. what is the most likely reason for this high
    11·1 answer
  • What is photosynthesis???​
    14·1 answer
  • The best method to improve air quality is to
    12·1 answer
  • Question 4 of 10
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!