1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lord [1]
3 years ago
11

Thr human male gamete is called a sperm cell and is produced in the

Biology
2 answers:
Vadim26 [7]3 years ago
5 0
Seminiferous tubules is where the perm is created
notsponge [240]3 years ago
5 0
Spermatozoa hope this helps
You might be interested in
In meiosis, the original cell is diploid or haploid
Vladimir [108]
The parent cells are diploid.
8 0
3 years ago
The renal corpuscle consists of a capillary bed called the ____________ and a capsule of epithelial cells.
pychu [463]

The renal corpuscle consists of a capillary bed called the glomerulus and a capsule of epithelial cells. The renal corpuscle is composed of two structures, the glomerulus and the Bowman's capsule. The glomerulus is a small tuft of capillaries containing two cell types. <span>It is also characterized as a cluster of capillaries around the end of a kidney tubule, where waste products are filtered from the blood. Other surfaces that separate body cavities from the outside environment are lined by simple squamous, columnar, or pseudostratified epithelial cells.The gastrointestinal tract, the insides of the lungs, and the reproductive and urinary tracts where other epithelial cells line up make up the exocrine and endocrine glands.</span>

3 0
3 years ago
Why are coastal wetlands important and what are the sources of pollution that affects them?
vaieri [72.5K]
Coastal habitats provide ecosystem services essential to people and the environment. ... Services provided by coastal wetlands include: Flood Protection: Coastal wetlands protect upland areas, including valuable residential and commercial property, from flooding due to sea level rise and storms. pollution kills much of the life that lives there and radically decreases biodiversity
3 0
3 years ago
Please select the word from the list that best fits the definition
Harrizon [31]

Answer:

Diffusion

is the movement of molecules from an area where there are many to an area where there are few

Hope it helps

4 0
2 years ago
What type of cell must contain a mutation for it to be passed down from women to offspring?
kumpel [21]
The mutation must occur in the egg cell
5 0
3 years ago
Other questions:
  • Imagine that you live near a large marsh and you just heard that they are going to build a shopping development over it. ... Wri
    5·1 answer
  • Which is more likely to be the cause of down syndrome the egg or the sperm
    13·2 answers
  • Los aerosoles a base de CFC producen:
    14·1 answer
  • What is the importance of nitrogen, carbon, and water cycles
    15·1 answer
  • With the following symptoms—redness and edema at the IV site, pain along the course of the vein, and if severe, fever, malaise,
    10·1 answer
  • What is the name for the diffusion of water across a semipermeable
    5·1 answer
  • Mention any two of the functions of proteins in animals​
    13·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Explain how a person can be a carrier for a sex-linked disorder, but not exhibit this disorder.
    15·1 answer
  • if someone spills very hot coffee on their skin causing great pain, which receptors would be stimulated? (choose all that apply)
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!