1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
julia-pushkina [17]
3 years ago
10

Resting membrane potential is created as a result of a greater net flow of positive charges from the ____________ .

Biology
1 answer:
vichka [17]3 years ago
3 0

Answer:

ICF to ECF

Explanation:

This is achieved by the evacuation of potassium ions (K+ ions) and sodium ions (Na+) from the inside of the neuron cells to the outside through ion channels. This process requires energy. This eventually leaves the inside of the cell electronegative relative to the outside (usually leaving an emf of -70mV).

You might be interested in
What is a stage of both technological design and scientific investigation?
maks197457 [2]

Answer:

Research related information

Explanation:

Research related information can be the stage. This is because it makes use of technology and scientific investigation..

Sorry if I'm wrong :'(

5 0
3 years ago
Read 2 more answers
Why would scientists may want to know if two plant species are closely related.
vaieri [72.5K]
2 related plants may produce similar substances that could be used for medicines
4 0
2 years ago
Read 2 more answers
Some individuals have defective genes for LDL receptor receptors rendering them nonfunctional. Individuals with these mutations
deff fn [24]
Individuals with these mutations typically have familial hypercholesterolemia.
These genes provide information for the formation of the low-density lipoprotein receptor, a receptor that binds to low-density lipoproteins (LDLs). LDLs carry the cholesterol in the blood and regulate the amount of cholesterol in the circulation. Mutations to these genes either reduce the number of receptors or cause several disruptions to their function. This results in high blood cholesterol levels and in a higher risk for heart disease.
6 0
3 years ago
Read 2 more answers
Earth's climate history can be studied by analyzing _____.
weqwewe [10]

Answer: Ice cores.

Explanation: Ice cores are commonly studied by scientists to find out what the climate was like decades and centuries ago.

3 0
3 years ago
The primary gas in a volcano is
PtichkaEL [24]
<span><span>Hi JayBo22!
Volcanic gas have water vapor, carbon dioxide and sulfur!
Fun Fact: You can find nitrogen, argon, helium, neon carbon dioxide, hydrogen, and methane.
I hope this helps;)

</span></span>
5 0
2 years ago
Other questions:
  • Living microorganisms found in soils and waters are generally capable of growth on common laboratory media. select one:
    6·1 answer
  • Natural selection is based on Darwin’s observation that individuals most likely to survive and reproduce are those _____.
    8·1 answer
  • Which statement describes the work of Aristotle and Linnaeus?
    8·2 answers
  • ANSWER ASAP!!!!!!
    9·2 answers
  • If you observed a cell under a microscope and saw that it contained a plasma membrane, cell wall, and ribosomes, but no other or
    10·2 answers
  • There are two main functions for polysaccharides in living things. Discuss these two functions, and how the structures of polysa
    15·1 answer
  • About 16% of the world's total oil output:
    13·2 answers
  • It is not in biology but math what
    9·1 answer
  • Des a magnetic field flows though the inside of a magnet
    10·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!