1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
pantera1 [17]
3 years ago
9

Compare and contrast relationships between organisms such as mutualism, predation, competition and commensalism

Biology
1 answer:
kompoz [17]3 years ago
5 0
Hello

compare<span> and/or </span>contrast relationships between organisms<span>, </span>such as mutualism<span>, </span>predation<span>, parasitism, </span>competition, and commensalism<span>. Students will describe and/or explain the roles </span>of<span> and </span>relationships among<span> producers, consumers, and decomposers in the process </span>of<span> energy transfer in a food web.
</span>
Have a nice day
You might be interested in
what would most likely have happened to the first finch with the big beak if it had been born on the continent of south america
Alecsey [184]
The correct answer is It would have outcompeted the other finches in the area.
6 0
3 years ago
Which of the following is a product of photosynthesis?the products of photosynthesis are sugar (glucose and oxygen?
olya-2409 [2.1K]
The products of photosynthesis are glucose and oxygen.<span> Photosynthesis takes in carbon dioxide and water and combine them in the presence of energy from the sun to make food for the organism</span>
6 0
3 years ago
Read 2 more answers
Which of the following does not show the law of conservation of mass?
EastWind [94]
Is there a photo or something
8 0
4 years ago
Read 2 more answers
Which is NOT a critique of neuroscience?
timofeeve [1]

D. Brain activity doesn't necessarily cause behaviour just because they coincide.

Explanation:

  • Neuroscience is the study of the neurons. This deals with how the nervous system develops, the structure of the nervous system and its actions.
  • Neuroscientists are focusing on the brain and its impact on cognitive functions and behaviour.
  • Scientists proved that the chemicals present in the brain are responsible for our general state and mood that we are going through. Damage of brain cell will affect our impulses and the impulsive behaviours.

4 0
3 years ago
Which is a common type of map projection?
Fed [463]

Answer:

OPINION D

Explanation:

8 0
4 years ago
Read 2 more answers
Other questions:
  • Which families of metals are not so reactive, which allows them to exist by themselves in nature?
    7·1 answer
  • In most mammals, the left lung is divided into how many parts?
    14·1 answer
  • Questlon 2 of 10
    9·1 answer
  • The a large group of animals migrates from a summer breeding ground to a warmer winter ground. Which type of adaptation does thi
    6·2 answers
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • Which of the following remains constant in Earth's carbon cycle?
    12·1 answer
  • Where do faults normally happen
    12·1 answer
  • PLEASE HELP ME
    10·2 answers
  • Pleaseee someone help this is due soon! xx
    6·1 answer
  • Select the TRUE statement about a resting neuron. a.) The cytoplasm side of a neuron is positively charged while the outside of
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!