1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Jlenok [28]
3 years ago
8

Mitosis results in the formation of how many cells

Biology
1 answer:
uysha [10]3 years ago
8 0
Mitosis of a single cell results in two daughter cells
You might be interested in
When this organelle malfunctions, the release of food energy into the cell would be
Mkey [24]

Answer:

d

Explanation:

Mitochondria is the power house of the cell. It's where aerobic respiration happens and release of energy as ATP happens.

6 0
3 years ago
The foxglove plant, seen in the illustration, produces very toxic chemicals that can cause serious illness and death in any orga
s2008m [1.1K]

There is no answer ,you wrote the answers with the question

4 0
3 years ago
Read 2 more answers
Bacteria that use sunlight as an energy source are considered A. photoautotrophs. B. hetertrophs. C. saprobes. D. chemoautotroph
Zepler [3.9K]
The answer is A. i say this because when they use sunlight as energy, cabon dioxide and water are converted into organic material, they are used as cellular functions ( such as biosynthesis and respiration ). An able autotroph is able to make his own food. 
4 0
3 years ago
Read 2 more answers
In an experiment, researcher want to determeain if the _____variable cause changes in______ variable
asambeis [7]
The answer is independent and dependent. I hope this helps! I'm sorry if I'm wrong.
8 0
3 years ago
How are the three chromosomal aberrations different from each other?
Amiraneli [1.4K]

<span>1.) Deletions: A percentage of the chromosome is lost or removed. </span>

<span>2.) Duplications: A share of the chromosome is doubled, which results into an extra genetics.</span>

<span>3.) Translocations: A portion of a chromosome is relocated to an alternative chromosome.</span>

6 0
3 years ago
Read 2 more answers
Other questions:
  • True or false? all foods that have been irradiated are required to be labeled as such.
    15·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • What is the process that uses sunlight to make and obtain energy for producers
    7·1 answer
  • humans constantly breathe in oxygen yet the amount of oxygen in the atmosphere remain relatively constant explain why
    9·2 answers
  • What events are most likely to occur along a transform boundary?
    15·2 answers
  • The study of biological classification is called<br> Your answer<br> Help please
    8·1 answer
  • A snurfleguffle is an imaginary animal living in the arctic. Give an example of a possible trait which might be removed from exi
    12·1 answer
  • Write a 4-6 sentence paragraph on how the cell helps our body to function.
    9·1 answer
  • Liz is examining a plant cell under a microscope. She sees many small green strutures inside the cell. Her teacher explains that
    14·2 answers
  • Please help me with this it’s the last one I need
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!