Stress increases the release of cortisol, and the cortisol
helps people cope with the stress. If stress continues for prolonged periods of
time: the increased cortisol begins to have adverse effects on bodily and
mental functioning. Increased activity in the dopamine reward systems, the same
systems involved in drug addiction.
Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)
Explanation:
Answer: Option D
Explanation:
The bacterium which is known as flesh eating bacterium is known as Streptococcus pyrogenes.
The disease caused by this bacterium is an infection in which one or more than one bacterium is used to describe this disease.
This bacterium releases toxin that destroys tissues inside the body such as skin, fat, mucous.
This disease is known necrotizing fasciitis. Hence, the correct answer is Option D.
Answer:
Water-The entire process of water cycle takes place in almost five steps which includes the evaporation, condensation, precipitation, infiltration, and runoff. To begin with, water gets evaporated from the water bodies on the surface of earth like rivers, oceans etc. into the overlying atmosphere.
Nitrogen-The nitrogen cycle is split up into five main processes. These processes are nitrogen fixation, assimilation, ammonification, nitrification, and denitrification. Each of these play an important role in movement of nitrogen through the different ecosystems on earth.
Answer:
Convection
Explanation:
Definition
convection- the movement caused within a fluid by the tendency of hotter and therefore less dense material to rise, and colder, denser material to sink under the influence of gravity, which consequently results in transfer of heat.
