1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lilavasa [31]
3 years ago
12

Digitalized info can be used by computers true or false

Biology
1 answer:
DanielleElmas [232]3 years ago
4 0
True, because computers are digital machines, as they can read information.
You might be interested in
BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I
storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0
3 years ago
What is the correct order (starting from the surface) of Earth’s layers?
goblinko [34]

Answer is C - crust, mantle, outer core, inner core.


Crust -

Crust is the <em>outermost layer</em>. The thickness of the crust is about<em> 5 - 70 km.</em>


Mantle -

Mantle is the<em> second layer</em> from the Earth's surface. Thickness is about <em>2890 km.</em>

Mantle can be divided into two parts as <em>upper mantle and lower mantle.</em>


Outer core -

The thickness is about <em>2400 km</em>. It is made from mostly <em>iron and nickel.</em>


Inner core -

The <em>innermost part</em> of the Earth is inner core. Mainly made from <em>iron-nickel alloy</em>. It is solid sphere which has a radius <em>about 1220 km</em>.

3 0
4 years ago
Read 2 more answers
5. Circle the three anti-codons at the
mixas84 [53]

Answer:

5. Circled in red on attachment

6. Green arrows on attachment

7. Orange box in the attachment

8. Circled red on attachment

9. Blue boxes on attachment

10. Black line on attachment

11. It has already disassociated

12. Purple rectangle in attachment

13. GAC

14. Leucine

Explanation:

I think most of this worksheet is to be completed on your own model of transcription that you have made, however, I will label the diagram

5. tRNA molecules bring amino acids to the ribosome. They are recognisable by their "cloverleaf" shape. In the picture, you can see that they are attached to amino acids (and you can even see some in the ribosome). The codons are on the opposite side of the tRNA to the amino acid, and are 3 bases complementary to the codon on the mRNA, represented here as 3 rectangles.

6. As described above, you can see some tRNAs in the ribosome. These tRNAs have paired up with complementary codons on the mRNA strand via their anti-codons. This is indicated by the green arrow. This is how the mRNA dictates the sequence of the polypeptide chain and makes protein

7. I think this question is just checking you know where the amino acid goes. The amino acid is attached to the opposite site of the anti-codon indicated in the image.

8. The anticodon in the tRNA has been indicated in question 5. Anticodons refer to three bases that are complementary to a specific codon on mRNA, and specify a particular amino acid

9. Each codon refers to each triplet of nucleotides in the mRNA. I have indicated this as blue boxes on the mRNA transcript. You can tell where they are based on where the tRNA is binding, always in 3s

10. See the black line, this is a called a peptide bond, and is the bond that joins together the amino acids in a growing polypeptide chain. I have drawn it between the first two amino acids in the second image. The amino acids represent a string of molecules linked using this peptide bond, which is a covalent bond formed by a condensation reaction

11. The first tRNA is not shown in the second diagram because the peptide bond has already formed between Valine and Histidine, so the tRNA that brought Valine to the machinery has disassociated from Valine and the ribosome. It is then free to bind another Valine and join in other translation processes

12. The third codon is CUG. We can see the first codon is GUG, then CAU, and the next is CUG. This is labelled with a purple rectangle in the attachment

13. Base pairing rules state that C pairs with G, and that A pairs with U (or T on DNA). The codon is CUG, therefore the anti-codon must be GAC

14. Each codon corresponds to a particular amino acid sequence. The codon CUG corresponds to the amino acid Leucine. You can find this using a codon table, like the one attached here

6 0
4 years ago
How can an astronaut weigh different amounts when in different locations
Usimov [2.4K]
So, there’s this thing called the force of gravity and on Earth, it is what keeps you on the ground. On Earth, gravity gives physical objects weight. But the moon’s gravity is much weaker. This means that you would weigh less on the moon because there’s less gravity and it’s harder to stay down. This is why astronauts can look like they are hopping and skipping on the moon’s surface. Compared to Earth, they feel weightless.
4 0
3 years ago
Explain this image, using all of the terms above. *
olasank [31]
The image is describing photosynthesis, the pansy absorbed carbon dioxide, sunlight, and water as nutrients and in return excretes/ produces oxygen and glucose.
3 0
3 years ago
Other questions:
  • The Effect on Rogotti on hair growth
    8·1 answer
  • Can you explain why the presence of three types of pigments (chlorophyll a, chlorophyll b, and carotenoids) increase the functio
    10·1 answer
  • What does water intensive mean
    11·2 answers
  • What is NOT a disadvantage of internal fertilization?
    9·1 answer
  • A group of dog offspring is known as a?
    8·1 answer
  • What does evolution mean?
    6·2 answers
  • Please help me?!!! I NEED HELP ASAP
    15·2 answers
  • The model shows a mutation to a partial sequence of bases in a gene.
    8·1 answer
  • This is because ions move from an area of ______ concentration to an area of ______ concentration.
    5·2 answers
  • Why might an idea or hypothesis be discarded?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!