✧･ﾟ: *✧･ﾟ:* *:･ﾟ✧*:･ﾟ✧
Hello!
✧･ﾟ: *✧･ﾟ:* *:･ﾟ✧*:･ﾟ✧
❖ The term that matches this statement is Metaphase. Metaphase occurs in Mitosis and Meiosis. The homologous chromosomes line up in single file.
~ ʜᴏᴘᴇ ᴛʜɪꜱ ʜᴇʟᴘꜱ! :) ♡
~ ᴄʟᴏᴜᴛᴀɴꜱᴡᴇʀꜱ
The peppered moths signified that animals are able to adapt to their environment in order to survive. This can be seen when moths evolved to a darker shade in order to survive and produce offspring.
A community should use sustainable practices to produce food because "it protects the environment, farming communities and farmed species".
<u>Answer:</u> Option B
<u>Explanation:</u>
The practice of sustainable food production is a united network that integrates several components with the development of each and every individual covered in the food chain in order to protect the environmental, economic and social well-being of a community.
The advantages of such practice are production of less greenhouse gases, fossil fuel utilization is minimized and more dependent on human labor inspite of chemicals and energy-intensive technology. Sustainable farms conserve scarce water resources, encourage biodiversity and build healthy soil through composting and planting techniques that cover crops.
Answer:
AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication
Explanation:
