1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
White raven [17]
3 years ago
12

What groups of objects do you classify based on their observable characteristics answer?

Biology
1 answer:
Bingel [31]3 years ago
8 0
Science subject demonstrate observation
Social welfare department observation
You might be interested in
The earth's surface tends to lose heat in winter. Which of the above cities would have the warmest average winter temperature? W
Zepler [3.9K]

Explanation:

Of the energy that reaches the Earth from the Sun, a small amount is absorbed by the atmosphere, a larger amount (about 30%) is reflected back to space by clouds and the Earth's surface, and most of it is absorbed at the planet surface and then released as heat. 

Energy is transferred between the Earth's surface and the atmosphere in a variety of ways, including radiation, conduction, and convection.

Molecules of all substances, even solids, have random motion and therefore an associated kinetic energy and temperature. ... Completely empty space would have no temperature since there are no molecules there.

(this is not much but hope it helps u)

4 0
3 years ago
Ok how about my guinea pig? Please don't report.
Rama09 [41]
Beautiful lolhxoydiylhdljxluflueoyful
8 0
3 years ago
Read 2 more answers
Which of these is a basic unit of macroevolution?
Alla [95]
The correct answer is Individual.

Species is the basic unit of macroevolution.
We can term macroevolution as a large-scale change at the species level which results in the formation of new species.
3 0
3 years ago
What does 1 hour in the sun do to the human skin ncmbi?
Sladkaya [172]

It can damage collagen fibers, destroy vitamin A in skin, accelerate aging of the skin, and increase the risk of skin cancers. Excessive sun exposure can also cause cataracts and diseases aggravated by UVR-induced immunosuppression such as reactivation of some latent viruses.

3 0
3 years ago
Which of the following is an example of a plant or animal depending on a nonliving thing in its habitat?
ryzh [129]

Answer:

C. Zebras depend on soil to grow grass, which the zebras eat.

give brainliest plz

6 0
3 years ago
Other questions:
  • What involves the movement of materials inside the cell?
    7·1 answer
  • Help in these two please I need help with this
    13·1 answer
  • As a nurse about to administer a medication tells the client about the ordered drug, the client states, "i am not going to take
    8·1 answer
  • How are plantlike protists classified into different groups
    9·1 answer
  • During the g2 phase, the cell is preparing for mitosis. using your knowledge of cellular organelles and molecules, which molecul
    13·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • Which of the following correctly explains why the first anaerobic organisms on earth are not classified as autotrophs? Chemicals
    8·1 answer
  • How does energy flow within an ecosystem
    14·2 answers
  • Cell theory is the current leading theory used to describe characteristics of living things. Which of the following is NOT part
    15·1 answer
  • In Mendel's experiments, he discovered a difference in the F1 and F2 generations. What difference did Mendel observe?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!