1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
cricket20 [7]
3 years ago
13

Does areolar tissue undergo mitosis?

Biology
1 answer:
Crank3 years ago
5 0
Yes they can to create new tissues
You might be interested in
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
What is the effect of light bulb color on the number of moths attracted to the light bulb?
PolarNik [594]
The effect is that the wires inside the  system of the light bulb will easily break and cause the light bulb to bust  
7 0
3 years ago
Nutrients enter a cell ______ the concentration gradient by the process of _______.
LenKa [72]
The correct answer is a. with; diffusion
5 0
4 years ago
Read 2 more answers
What is the role of the water test tube in each phase
ElenaW [278]
I need more information
7 0
3 years ago
The particles in a hot pan have ____________ kinetic energy than the particles in a cool oven mitt.
aleksandrvk [35]
The particles in a hot pan have greater kinetic energy than the particles in a cool oven mitt.

This is because as the temperature of an object increases, the particles gain more energy and therefore move faster, increasing kinetic energy.

I hope this helps, feel free to ask any questions you may have
7 0
3 years ago
Read 2 more answers
Other questions:
  • Lymphoid tissue that appears as a swelling of the mucosa in the oral cavity is called a(n) _____________ .
    13·1 answer
  • WILL GIVE BRAINLIEST PLEASE HELP
    15·2 answers
  • What structure in the retina is primarily responsible for night vision as opposed to day vision?
    11·1 answer
  • Nostrils are lined with tissue that contains cilia. The tissue helps keep dust and other foreign particles out of the body.
    13·1 answer
  • Planting the same crop over and over causes:
    5·1 answer
  • When a car rolls straight down a steep hill, what happens tot he car
    5·1 answer
  • Which of the choices below is not a function of the urinary system? A. helps maintain homeostasis by controlling the composition
    5·1 answer
  • In an animal that switches between sexual and asexual reproduction is called
    10·1 answer
  • How do bacteria in hydrothermal vents produce food?
    8·1 answer
  • What does mRNA do?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!