1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
irga5000 [103]
3 years ago
13

Select all that apply. Hemoglobin _____.

Biology
1 answer:
KatRina [158]3 years ago
8 0
What are the answer choices
You might be interested in
This is a process by which substances are transported across cell membranes by means of protein carrier molecules
8_murik_8 [283]

i think the answers is Exocytosis

6 0
3 years ago
When an organism reproduces it makes another organism of the<br> same…
Novosadov [1.4K]

Answer:

species-(i think?)...or maybe family?

Explanation:

well, it's basic genetics. if two organisms of the same species reproduce, a new organism of that species is born. however, if two organisms of different species reproduce, the offspring will be either nonexistent or hybrid. when an offspring is created, it belongs in the same family as its parents.

3 0
3 years ago
What part of the DNA is responsible for the inheritance of trait
Karolina [17]

Answer:

Within cells, the long strands of DNA form condensed structures called chromosomes. Organisms inherit genetic material from their parents in the form of homologous chromosomes, containing a unique combination of DNA sequences that code for genes.

5 0
3 years ago
A population of ground squirrels has an annual per capita birth rate of 0.06 and an annual per capitadeath rate of 0.02. Calcula
bearhunter [10]

Answer:  is C

Explanation : Ground squirrels has an annual per capita birth rate of 0.06 and an annual per capita death rate of 0.02. Calculate an estimate of the number of individuals added to (or lost from) a population of 1,000 individuals in one year

 HOPE THIS HELPS

8 0
4 years ago
PLEASE HELP asap all ik its not D
polet [3.4K]
It has to be B. the egg develops in the uterus and is released one time each month after menstruation. it dies after 24 hours if not fertilized within those hours.
5 0
3 years ago
Other questions:
  • What is The function of the adenoids
    9·2 answers
  • Select the description of mRNA. a.a three‑dimensional complex of ribonucleotides and proteins that assembles polypeptide chains
    12·1 answer
  • The Law of Overcompensation and Overload allows for which of the following in regards to intensity?
    15·1 answer
  • Which of the following is the best definition of the term phenotype?
    14·2 answers
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • The Maplewood Marine Restoration Project will seek to dredge sand and substrate from the
    5·1 answer
  • How does blood go through the heart?
    9·2 answers
  • Which of these limitations has the greatest impact on the European and American weather models?
    7·2 answers
  • Certain flightless beetles have wings. Their wings are an example of which type of structure? Question 3 options: vestigial stru
    8·1 answer
  • The diagram below represents changes in the types of plants growing in the same area during four different time periods. Differe
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!