1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
monitta
3 years ago
13

For each example of symbiosis researched—mutualism, commensalism, and parasitism—write a short paragraph (2-4 sentences), explai

ning how symbiosis functions in the partnership.
40 PTS GUYS PLZ HELP AND DO IT WELL
Biology
1 answer:
Thepotemich [5.8K]3 years ago
5 0

Answer-

Commensalism is a type of relationship where one of the organisms benefits greatly from the symbiosis. The other is not helped but is not harmed or damaged from the relationship. In other words, this is a one-sided symbiotic relationship.

In parasitism, one organism benefits from the relationship but at the expense of the other. The organism may live inside the other's body or on its surface. In some of these parasitic relationships the host dies and in others, it is important that the host remain alive.

Mutualism is a close relationship where both parties benefit. Both species will benefit from the relationship and many of these relationships are ling-lasting.

Your Welcome

You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Humans can use many methods to reduce their impact on the environment. Match each method below with an example.
ipn [44]

1. A logging company plants two acres of land with

trees for every one acre of forest it removes -B. using resources sustainably-



2. Julia uses old glass jam jars as pots for

her plants-C. recycling resources-



3. Jackson installs a solar-powered water heater

to supply his house with hot water-A. using renewable resources-

5 0
3 years ago
Read 2 more answers
The starfish's water-vascular system is used for locomotion and capturing food. True/False
Ymorist [56]

Answer:

true

Explanation:

3 0
3 years ago
5 points for a easy question
kompoz [17]

Globalized evolution...... but I might be wrong

6 0
3 years ago
Read 2 more answers
Kira is a hemophiliac. This means that she does not produce clotting factors. What aspect of the clotting process should she be
meriva
A hemopheliac is someone with a bleeding disorder resulting from any missing clotting factors in their blood. Vasoconstriction isn't generally the problem in hemophiliacs, nor is it the destruction of pathogens. If fibrin threads are not present to help form the platelet plug, then excessive bleeding occurs. Fibrin is one clotting factor that a hemophiliac may be missing which is then causing the disorder.
8 0
3 years ago
Other questions:
  • At the onset of the embryonic period, the _____ appear(s). it will eventually become the neural tube.
    11·1 answer
  • 2. Name the sympathetic ganglia in which the preganglionic and postganglionic neurons synapse.
    15·1 answer
  • I need help with dis, the lil box are the definition and I need to match the terms . CAN ANYONE HELP PLEASE ASAP
    7·1 answer
  • The formation of fossil fuels in the carbon cycle serves to:
    6·1 answer
  • A piece of iron is heated and then cooled by dropping it in water. The heat lost by the piece would be higher if
    14·1 answer
  • A and B are solutions of salt dissolved in water that are separated from each other by a semipermeable membrane in each scenario
    13·1 answer
  • 15. The complex carbohydrates pictured below are made by linking
    12·1 answer
  • In the endocrine system, what is the function of a negative feedback loop?
    5·2 answers
  • HELP PLEASEE
    12·2 answers
  • What is staminate flower? Find out any one dissimilarity among bacteria and fungi.​
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!