1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zubka84 [21]
3 years ago
6

In addition to the core regions, the "where" pathway for audition includes the: belt and parabelt regions and the posterior pari

etal cortex. anterior parts of the auditory cortex. belt and parabelt regions and the anterior parts of the temporal cortex. posterior parts of the auditory cortex and the posterior parietal cortex.
Biology
1 answer:
trasher [3.6K]3 years ago
5 0

Answer:

The superior temporal gyrus (STG) is on the inferior–lateral brain surface near the external ear. In macaques, 2/3 of the STG is occupied by an auditory cortical region, the “parabelt,” which is part of a network of inferior temporal areas subserving communication and social cognition as well as object recognition and other functions. However, due to its location beneath the squamous temporal bone and temporalis muscle, the STG, like other inferior temporal regions, has been a challenging target for physiological studies in awake-behaving macaques. We designed a new procedure for implanting recording chambers to provide direct access to the STG, allowing us to evaluate neuronal properties and their topography across the full extent of the STG in awake-behaving macaques. Initial surveys of the STG have yielded several new findings. Unexpectedly, STG sites in monkeys that were listening passively responded to tones with magnitudes comparable to those of responses to 1/3 octave band-pass noise. Mapping results showed longer response latencies in more rostral sites and possible tonotopic patterns parallel to core and belt areas, suggesting the reversal of gradients between caudal and rostral parabelt areas. These results will help further exploration of parabelt areas.

Explanation:

Auditory cortex has been less extensively studied in primates than visual cortex, and little is known about auditory cortex organization in galagos. The standard model for the early stages of processing in auditory cortex of primates now includes a core of three primary or primary-like areas, A1 (the primary area), R (the rostral area), and RT (the rostrotemporal area), surrounded by a belt of eight secondary areas, bordered laterally by a parabelt, a third level of cortical processing of two divisions

You might be interested in
BRAINLIEST!! Are frogs reptiles or amphibians.
Talja [164]

Answer:

amphibians because it is a cold blooded vertebrate and has aquatic gill breathing larvea

Explanation:

6 0
3 years ago
Read 2 more answers
Do you think natural or synthetic resources are more important to our way of life? Justify your answer.
Alchen [17]

Answer:

no

Explanation:

synthetic folic acid is way more harmful then the natural folate in foods, it may build up in the body and raise cancer, and synthetic copies of natural chemicals are not as good for you

5 0
3 years ago
Read 2 more answers
Question 7 of 20 :
Scilla [17]

Answer:

Toxic Algae Blooms

Explanation:

Floodwater deposits a large amount of sediment. excess nutrients promote the growth of algae is a cause of eutrophication.

6 0
3 years ago
Answer needed soon help ASAP please
Anestetic [448]
Answer: Nerve cell
Cells of the nervous system, called nerve cells or neurons, are specialized to carry "messages" through an electrochemical process.
3 0
4 years ago
Read 2 more answers
The scientific name for the domestic dog is Canis familiarus and for the wolf, it is Canis lupus. The dog and the wolf are in th
Mashutka [201]

Answer:

genus

Explanation:

5 0
2 years ago
Read 2 more answers
Other questions:
  • Based on figure 21-1 ,animals are most closely related to
    9·2 answers
  • According to the chart below, which planet has the smallest inner core?
    8·2 answers
  • What role do cfcs play in the catalytic destruction of ozone?
    10·1 answer
  • Since the endangered species act of 1973 was passed, about ______ species of animals and ______ species of plants and lichens ha
    12·1 answer
  • In order to support his theory of evolutionary change, Charles Darwin concentrated his studies on the many species of finches in
    6·2 answers
  • Which of the following is not an effective way to manage forests and trees?
    13·2 answers
  • Which is true for a substance in the gaseous phase?
    14·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • What is occurring during the s phase of the cell cycle?
    10·1 answer
  • The amount of light in the Epipelagic zone
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!