1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
timofeeve [1]
2 years ago
12

The probability of flipping a coin twice and getting heads is_______

Biology
2 answers:
ira [324]2 years ago
8 0
the probability is 50/50
Free_Kalibri [48]2 years ago
6 0
50/50
you see, the coin only has 2 sides
Also, you're flipping it twice
therefore, the probability is matched up and you have a 50/50 chance of getting heads at least 1 of those 2 times
(Hope it helped ^_^)
You might be interested in
The most common type of workplace violence in healthcare settings is
marusya05 [52]
Answer;
Worker-on-worker violence
The most common type of workplace violence in healthcare settings is worker-on- worker violence.

Explanation;
Workplace violence is any physical assault, threatening behavior or verbal abuse occurring in the work setting.
Worker-on-worker violence is often directed at persons viewed as being "lower on the food chain" such as in a supervisor to supervisee or doctor to nurse though incidence of peer to peer violence is also common. 
4 0
3 years ago
What causes a branch in cladogram
balandron [24]

Answer:

(look at explanation)

Explanation:

A new branch in a cladogram is given when a new trait arises that sets apart those organisms from the rest of the clade. ... Although the organisms within a clade and their shared ancestor will have similar characteristics each branch will have a unique character or trait.

4 0
3 years ago
PLEASE HELP!!!!! 40 pts!!!
GenaCL600 [577]

Answer:

Sodium Chloride :>

Explanation:

5 0
2 years ago
Read 2 more answers
Question 3
marysya [2.9K]

Answer:

"it was once part of the organisms from which the fossil fuels formed"

4 0
3 years ago
Which of the following rocks most likely resulted from compacting and cementing particles together? A. slate B. pumice C. marble
yuradex [85]
Sandstone rocks<span> are most likely the result of compacting and cementing particles together.</span>
6 0
3 years ago
Other questions:
  • When you walk your dog your using energy from the sunlight to power this activity how?
    6·1 answer
  • The structure of hemoglobin consists of ____________ chains. two of the chains are ____________ and two are beta proteins. each
    7·1 answer
  • How organelles work together to help maintain the cells homostasis ?
    10·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • What "gem" is formed as a result of the Carbon Cycle
    10·1 answer
  • 15. Compare and contrast food webs based on photosynthesis and chemosynthesis.
    10·2 answers
  • Plz help last question on my test
    15·2 answers
  • Fossils cannot be used to explain changes in the earth.
    6·1 answer
  • Tiying pe
    6·1 answer
  • A cell that begins meiosis has 23 chromosomes inherited from the mother (shown in
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!