1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
motikmotik
3 years ago
6

Snails and insects belong to which group of organisms?  

Biology
2 answers:
adoni [48]3 years ago
6 0
<span>They are both invertebrates.</span>
Rufina [12.5K]3 years ago
3 0
<span>They both are both invertebrates and belong to the domain Eukaryota and the kingdom Animalia. They have no other taxonomic groups in common. Snails belong to the phylum Mollusca and insects belong to the phylum Arthropoda.</span>
You might be interested in
Summary of the sympathetic nervous system?
ycow [4]
The sympathetic nervous system activates what is often termed the fight or flight response. ... In response to this stimulus, postganglionic neurons principally release noradrenaline (norepinephrine). Prolonged activation can elicit the release of adrenaline from the adrenal medulla.
3 0
3 years ago
MATch the stages of interphase which what occurs in each stage
MAVERICK [17]

The Cell's Cycle first phase which consists of three stages: G1 phase, S phase, and the G2 phase. The first phase in Interphase in which the cell duplicates organelles and cytosonic components which are metabllicly active. The second stage of Interphase in which DNA replication occur.


3 0
3 years ago
Receptors that provide animals with information from their internal environment are located in _____. the eyes and ears blood ve
Sergio039 [100]
Those receptors are located in the head, where the eyes and ears are located.
7 0
3 years ago
Read 2 more answers
What is the name of the energy containing molecule created by cellular respiration
Flauer [41]

Answer: ATP

Explanation: ATP molecules can be made per oxidized<u> glucose molecule during cellular respiration</u> (2 from glycolysis, 2 from the Krebs cycle, and about 34 from the electron transport system).

7 0
3 years ago
Anaerobic exercise is an intense activity that lasts a short period of time. This
slega [8]
C. In anaerobic exercise muscles do not use oxygen. In aerobic exercise muscle use oxygen.
6 0
2 years ago
Other questions:
  • Which virus has a structure that includes an outer lipid bilayer that is studded with proteins?
    15·2 answers
  • Why does the oxygen atom in a water molecule have negative charge?
    15·2 answers
  • Use the drop-down menus to answer some questions about dermal tissue
    15·1 answer
  • What might cause a virus in the lysogenic cycle to suddenly enter the lytic cycle? mutations in the viral capsid
    15·2 answers
  • Certain foraminifera (shelled protozoa) have inconsistent fossil records. Which mode of evolution do they represent?
    11·2 answers
  • What's an area of high pressure where air moves apart and sinks
    9·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Which characteristics describe cnidarians? Check all that apply.
    13·2 answers
  • What is the chemical equation that represents cellular respiration and what organelle it takes place in
    9·1 answer
  • Which of the following is not a function of Carbohydrates in your cells?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!