Surfaces where O2 diffuses into the blood and CO2 diffuses out of the blood. Each lung contains millions of these sacs. The small round alveoli allow for an amazingly large surface area for this gas exchange to take place. ... Therefore, the greater the surface area, the more gas exchange can occur.
The energy pyramid shows a decrease moving up trophic levels. For example, when a herbivore eats a plant, it only gets a part of the plant energy, so the energy taken by the herbivore will be lesser. The same thing also happens when the carnivore animal eats herbivore animals. <span>
</span>
Answer:
The myofibrils are the contractile organelles in the muscle fibers.
Answer:
If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG
If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG
Explanation:
Answer:
local is the warning of ancestry then general have confuse to important scientific
