1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
PolarNik [594]
3 years ago
15

When water vapor in the atmosphere cools, it may form ___?

Biology
1 answer:
Masteriza [31]3 years ago
7 0

When water vapor in the atmosphere loses heat and cools down, condensation happens


Condensation: is the change of water from gas form to liquid form


Answer:B. gas

You might be interested in
A medical study was investigating if getting a flu shot actually reduced the risk of developing the flu. A hypothesis test is pe
weqwewe [10]

Answer:

d. Researchers said the flu shot reduced the risk of developing the flu when it actually didn't.

Explanation:

A Type I Error can be defined as the error that occurs in hypothesis when a researcher rejects the opposite of his hypothesis even though the opposite of his hypothesis is correct or true. Type I Error can also be called a False positive.

In the question above an hypothesis was carried out by researchers to determine if getting a flu shot would reduce the risk of developing a flu.

The truth is " Getting a flu shot actually reduces the risk of developing a flu"

But the researcher hypothesis test result that would result in a Type I error says "Researchers said the flu shot reduced the risk of developing the flu when it actually didn't".

This result of hypothesis test of the researchers above is a rejection of truth (the truth is an opposite of the researchers hypothesis test) and it would result in a Type I Error.

7 0
3 years ago
Read 2 more answers
A species of birds entered a nonnative habitat and is now considered an invasive species. What’s the most likely effect this spe
kati45 [8]

Answer:

The resources will be mostly taken up by the invasive birb species

Explanation:

The resources cannot be evenly divided between the species as the harmony has been interrupted

7 0
3 years ago
Please Help, I Will Mark Brainliest
Crazy boy [7]

Answer:

CAGGAAATTGTAGCTAACCTTTTGCAATTTTAGGTCAAGGTA

Explanation:

Cytosine pairs with Guanine.

Adenine pairs with Thymine.

5 0
3 years ago
Can one process go on continually without the other? Be sure to support your answer with what you have learned about each proces
Damm [24]
I don't think one process can go on continuously without the other. Because during the photosynthesis carbon dioxide is necessary along with sunlight, water to make glucose and oxygen. Without oxygen we won't survive if we don't survive then there will be no carbon dioxide. Aerobic respiration is when you take in oxygen made by plants in the process of photosynthesis as the product of aerobic respiration we breath out carbon dioxide which plants use to make glucose and oxygen.  
4 0
3 years ago
I’m order to maintain a stainable internal environment the cells of all living organisms must be able to
olga55 [171]

Answer:

Maintain homeostasis.

Explanation:

4 0
4 years ago
Other questions:
  • Provide one example<br> where an abiotic factor could have a devastating effect on an ecosystem
    13·1 answer
  • What molecule helps to ensure that dna replication is accurate?
    8·1 answer
  • What kinds of plants were transformed into coal? bryophytes gymnosperms ferns and their relatives angiosperms?
    14·1 answer
  • Which post disaster phase is generally characterized by optimism due to an infusion of resources?
    15·1 answer
  • describe photosynthesis in terms of which organism use it and the energy that drives itdescribe photosynthesis in terms of which
    14·2 answers
  • What is the ploidy of the most conspicuous form of most fungi?
    8·1 answer
  • Neurotransmitters are released into the _____, the gap between synaptic terminals and adjacent neurons, and then bind to special
    15·1 answer
  • An airplane was moving 1200 km per minute
    12·2 answers
  • !!!!!!!!PLEASE HELP!!!!!!!!!!!!!!!!!Why are rivers still able to flow during drought??????????
    6·1 answer
  • Why is coal considered a nonrenewable energy source
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!