What is a biome and how are biomes grouped

Biology

1 answer:

mr_godi [17]4 years ago

5 0

Answer:

Biomes are a group of ecosystems sharing the same characteristics and are well adapted to the prevailing abiotic factors. Any earth surface that has got a very large ecological system characterized by dominant forms of plant and animal life forms adapted to the prevailing climate and other environmental factors is termed as a biome. Biomes include both the abiotic and biotic factors.

Explanation:

You might be interested in

1. Which of the following might be a result of adding a secondary consumer to the aquatic ecosystem in the accompanying illustra

MatroZZZ [7]

Answer:

Option-(A): In an illustrated flowchart, the movement of carbon atoms through an aquatic food chain is indicated by arrows.
Option-(C)- An increase in the population of scavengers.

Explanation:

The ecological pyramid is comprised of different level of organisms as the energy flow occur through them in a more directed form inside the different spheres depending upon the medium for energy transmission across the given parameters or area. As, the arrow provides us with a more directed way for understanding the transmission of energy through different organisms and there respective levels inside the ecological pyramid.

While, the increase in the level of scavengers or the animals which consumes the left overs of other living beings is balanced with the addition of the secondary consumers to the aquatic ecosystem.As, it will provide equal chances and energy to the different beings inside the ecosystem.

5 0

3 years ago

Lipid is one of the major classes of biomolecules needed by the body. The body breaks down the lipids that we consume to create

Darina [25.2K]

So the breakdown of lipids actually starts in the mouth. Your saliva has this little enzyme called lingual lipase, which breaks down these fats into something called diglycerides. These diglycyerides then make there way to the intestines, where they stimulate the pancreas to release lipase (another fat breaking enzyme!) and the pancreas to release bile. The bile and pancreatic juices both work together to break these diglycerides into fatty acids. It’s helpful to know some of the root words. Glycerol- the framework to which the fatty acids stick. Glyceride- think of this guy as several fatty acids stuck to a glycerol. Lipids- think fats, and their derivatives (our glyceride friends.) tri/di/mono- these are just number prefixes! Lipids are one glycerol molecule, and then either one, two, or three fatty acids attached, which is where you get mono(1)/di(2)/tri(3)glyceride from. I know this was long, but hopefully it helps!

5 0

3 years ago

Which characteristic of life best describes the process of homeostasis?

pentagon [3]

Answer:

Responding to stimuli / the environment

Explanation:

8 0

3 years ago

The population of bats inhabiting a cave decreases. What are factors that could cause this decrease in the bat population?

sergejj [24]

Answer:

Lack of food, increase in predators, lack of space, too much competition within the population, lack of water

Explanation:

8 0

2 years ago

Read 2 more answers

1-5 For the following DNA sequences, replicate the DNA 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0

3 years ago

What is a biome and how are biomes grouped​

What is a biome and how are biomes grouped