1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anna35 [415]
3 years ago
12

What is the use of petals on a flower? Please answer it in sense of science.

Biology
1 answer:
sveticcg [70]3 years ago
3 0
Well there are pedals on a flower because they surround the reproductive parts of the flower and they are often bright colors or odd shaped to attract pollinators

Hope this helps
You might be interested in
Which part of the flower you eat when you eat an apple?
Keith_Richards [23]
When you eat a apple your eating the hypanthium tissue it could also be the core but i dont know anyone who enjoys eating the core.
6 0
3 years ago
Fill in the blank
Anarel [89]

Answer:

hydrogen

helium

plasma

auroras

magnetic

White dwarfs are lower on the scale of luminosity varying from .001 to 1, compared with the brighter luminosity of super giants that are measured at 10,000 and above. White dwarfs are in the blue to white stellar temperature, and super giants are measured as white on the stellar temperature.

Explanation:

8 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Construiește schema transferării energiei solare de la un nivel trofic la altul în livadă și lac.
Mice21 [21]
...........................................

4 0
3 years ago
In ____, several sets of alleles control the phenotype and each dominant allele present codes for a product which has a quantita
tatuchka [14]

Answer:

Polygenic inheritance

Explanation:

Polygenic inheritance occurs when a genetic trait is regulated by more than one genes. All the alleles of these genes together determine the phenotype of the organism for the polygenic trait. Here, the phenotype is regulated by the total number of dominant alleles for all the genes that regulate a polygene trait.

For example, human skin color is a polygenic trait. The final phenotype depends on the total number of dominant alleles of all the genes that regulate the skin color in human.  

6 0
3 years ago
Other questions:
  • Which element would most likely bond with lithium and form an ionic compound?
    7·2 answers
  • What amino acid is produced by the following DNA sequence? TGA
    12·1 answer
  • Bhdfhsklghslkeddszjsk;lfaeldjfaz
    8·1 answer
  • Which physical change takes place when an igneous rock turns into sedimentary rock?
    8·2 answers
  • What is the difference between a stable and unstable element
    14·2 answers
  • Okay so I have this presentation in science and I just have a quick question so my topic is “Ellipse” and I honestly don’t under
    7·1 answer
  • Explain how energy moves from one organism to another?
    8·1 answer
  • True or false. An ecosystem includes all the producers, consumers, and decomposers in an environment.
    10·1 answer
  • How many ATP molecules are made with each glucose in the Krebs?
    10·2 answers
  • PLEASE HELP!!! Lipids, also called fats or oils, can be found in cell membranes. Which of the molecules shown below is a lipid?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!