1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
BartSMP [9]
2 years ago
14

There are two basic ideas that are key to Darwin's Theory of Evolution. The first is that present day species are descendants of

ancient ancestors, called "Descent with Modification" the second is _____
Biology
1 answer:
Svetradugi [14.3K]2 years ago
7 0

Answer: Natural selection is the driving force to explain the mechanisms  of  evolution.

Explanation:

◼In a given population Organisms usually produce more offspring than what the environment can support.  

◼ VARIATION, is driving force  for  the manifestation of  sustainable inheritable characteristics from parents in a given population.

◼ Organisms, who acquired certain characteristics from variation; tend to survive than others, and therefore pass these inheritable characteristics to their offspring.

◼There is competition for the available resources among the offspring which leads to a stable population in size after a period of time.

◼Darwin deducted that, variants of best adaptation will be selected for by natural conditions operating in the environment of the population at that particular period (natural selection).Therefore natural selection takes place, and the organisms with best variation will have selective advantage above others. Consequently they have higher survival rates compare to others in the population.

This is   survival of the fittest by natural selection , this is the second conclusion  of Darwin theory.

You might be interested in
What is the most noticeable differences between the Hadeon period of
Nady [450]

Answer:

Hadean ("Hades-like") Era. This era began with the formation of the earth from dust and gas orbiting the Sun about 4.6 billion years ago. During this era the surface of the Earth was like popular visions about Hades: oceans of liquid rock, boiling sulfur, and impact craters everywhere, meanwhile, during, for example, the Cretaceous period, Earth's land assembled essentially into two continents, Laurasia in the north and Gondwana in the south. These were almost completely separated by the equatorial Tethys seaway, and the various segments of Laurasia and Gondwana had already started to rift apart, and there were oceans of seawater, teeming with life such as Mosasaurs and Ammonites. During the Cretaceous period, the land was hospitable and warm enough to support large numbers of lifeforms, including the dinosaurs.

Explanation:

6 0
3 years ago
Humans are the selective agent in which type of procces, artificial selection or natural selection
Aleonysh [2.5K]
Natural Selection, unless you were born in a lab which would be unnatural/artificial, and not too likely with today's technology. (Maybe one day.)
4 0
3 years ago
A certain element has a half-life of 1,000 years. How much of a sample of this element remains after 2,000 years?
quester [9]

Answer:

A quarter of the sample.

Explanation:

Let the quantity at the beginning be T. If the element has a half-life of 1,000 years, it means that after 1000 years, T/2 (which represents half the initial quantity available) would have decayed, remaining T/2.

After another 1000 years (making 2000 years), T/4 (which represents have of the quantity left after the first 1000 years) would have decayed, remaining T/4.

This means that only a quarter of T would be left after 2000 years.

5 0
3 years ago
How does producing plastics benefit the economy?
lord [1]
Producing plastics benefits the economy by employing workers and it helps the economy of every state by spending billions of dollars on shipping plastic products. 

Hope this helps! Have a good day. 
8 0
3 years ago
Read 2 more answers
Martha is telling her teacher how an animal cell is like a house. Which part of the animal cell is like the doors and windows in
Alisiya [41]

Answer:

cell membrane is like doors and windows!!

Hope this helps!

Explanation:

8 0
2 years ago
Read 2 more answers
Other questions:
  • What is the difference between the pulmonary and systemic circulations
    8·1 answer
  • Which difference between water and ice results in ice floating on cold water?
    14·1 answer
  • How would you break the carbohydrate protein and lipid molecules apart?
    10·1 answer
  • What is a cell culture and how can it be useful to biologists?
    12·1 answer
  • Are bacteria harmful to us? explain
    11·2 answers
  • How many copies of mitochondrial DNA is in the average cell?
    11·1 answer
  • Read the description of data collected in each of the following examples. Evaluate each situation and
    11·2 answers
  • 1. A(n) _____ shows you the schedule of payments on a loan and the total
    7·2 answers
  • Using the triple beam balance scale to find the mass of an object the first beam is 100, the second is 40 and the third is 7.2.
    5·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!