1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anna007 [38]
3 years ago
7

______ prevent or limit the ability of free radicals to damage polyunsaturated fatty acids and dna in cells.

Biology
1 answer:
vova2212 [387]3 years ago
5 0

The answer is A. antioxidants. Antioxidants is the defense system of the body, it is also the involved prevention of the damage of the cell; examples are aging, common reason of cancer and also different kinds of diseases. There’s always a need to have antioxidants because our body needs protection for the damage by the oxidation may cause.

You might be interested in
What is the term for the leaf openings responsible for gaseous exchange?
elixir [45]

Answer:

stomata are the openings in a leaf

7 0
2 years ago
Which of the following serves as the cell's boundary from its environment
Bad White [126]
B. Cell membrane
Remember cell membrane is the structure aka “wall of the house” is the clear boundary between the cells internal and external environments:))
Hope this helps
4 0
3 years ago
WRITING Connection Write a report about the effects on the
rewona [7]

Clearly your only giving 5 points but ok.

Answer:     Humans impact the physical environment in many ways: overpopulation, pollution, burning fossil fuels, and deforestation. Changes like these have triggered climate change, soil erosion, poor air quality, and undrinkable water.

Buy less plastic and bring a reusable shopping bag. Use long-lasting light bulbs. Energy efficient light bulbs reduce greenhouse gas emissions. Also flip the light switch off when you leave the room!

4 0
2 years ago
Haploid cells are the product of...
Wewaii [24]

Answer:

Meiosis

Explanation:

Because meiosis is a reduction division

5 0
3 years ago
What are the functions of carbohydrates, peripheral proteins, and cholesterol in the cell membrane?
Natalka [10]

Answer:

Some of these proteins serve to transport materials into or out of the cell. Carbohydrates are attached to some of the proteins and lipids on the outward-facing surface of the membrane. These form complexes that function to identify the cell to other cells.

3 0
2 years ago
Other questions:
  • Yes ,hamburger and french fries
    6·1 answer
  • Advantages of developing solar based equipment in future​
    13·1 answer
  • Turtles are higher on the _____ than insects?
    7·1 answer
  • What are two brand new cells called hint
    6·1 answer
  • ____________________ can happen anywhere along the spine if the neural tube does not close all the way. The backbone that protec
    10·1 answer
  • What similarities do mitochondria and chloroplasts
    12·1 answer
  • 48.Which is a significant environmental cost of burning fossil fuels that is not incurred with the use of the other energy resou
    14·1 answer
  • Which codon is the start signal for translation?<br> AUG<br> UAA<br> ATG<br> UGA
    9·1 answer
  • What happens when an organism genome (genetic code) is incorrectly copied or changed?
    7·2 answers
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!